Inherited or familial Creutzfeldt-Jakob disease (fCJD) and Gerstmann-Straussler-Scheinker syndrome (GSS) are rare forms of genetic prion disease characterized by cognitive difficulties, ataxia, and myoclonus¹. These diseases are associated with the larger Prion Disease phenotypic spectrum, but other phenotypes have not been associated with this tandem repeat².

Prevalence

<0.0225/1,000,000: <15% of CJ variants are repeat expansions³. 15% of newly diagnosed prion disease cases are genetic¹, 1 individual per million per year worldwide (350 cases annually in US)⁴. Found worldwide¹.

Age of Onset

Typical: 50-60¹; Range: 31-63⁵.

HPO Terms

HP:0000504 Abnormality of vision HP:0000505 Visual impairment HP:0000605 Supranuclear gaze palsy HP:0000639 Nystagmus HP:0000712 Emotional lability HP:0000716 Depression HP:0000726 Dementia HP:0000736 Short attention span HP:0000737 Irritability HP:0000738 Hallucinations HP:0000739 Anxiety HP:0000741 Apathy HP:0000746 Delusion HP:0000751 Personality changes HP:0001250 Seizure HP:0001262 Excessive daytime somnolence HP:0001269 Hemiparesis HP:0001289 Confusion HP:0001317 Abnormal cerebellum morphology HP:0001324 Muscle weakness HP:0001336 Myoclonus HP:0001337 Tremor HP:0001350 Slurred speech HP:0002066 Gait ataxia HP:0002067 Bradykinesia HP:0002072 Chorea HP:0002073 Progressive cerebellar ataxia HP:0002283 Global brain atrophy HP:0002312 Clumsiness HP:0002354 Memory impairment HP:0002381 Aphasia HP:0002401 Stroke-like episode HP:0002446 Astrocytosis HP:0002464 Spastic dysarthria HP:0002529 Neuronal loss in central nervous system HP:0002922 Increased CSF protein concentration HP:0003487 Babinski sign HP:0005327 Loss of facial expression HP:0006943 Diffuse spongiform leukoencephalopathy HP:0007009 Central nervous system degeneration HP:0007017 Progressive forgetfulness HP:0007076 Extrapyramidal muscular rigidity HP:0007158 Progressive extrapyramidal muscular rigidity HP:0007183 Focal T2 hyperintense basal ganglia lesion HP:0007256 Abnormal pyramidal sign HP:0007686 Abnormal pupillary function HP:0010542 Vestibular nystagmus HP:0010846 EEG with persistent abnormal rhythmic activity HP:0011099 Spastic hemiparesis HP:0012332 Abnormal autonomic nervous system physiology HP:0012672 Akinetic mutism HP:0025152 Poor visual behavior for age HP:0100256 Senile plaques HP:0100292 Amyloidosis of peripheral nerves HP:0100661 Trigeminal neuralgia HP:0100785 Insomnia

Association

Mendelian

Locus

hg19 chr20:4680043-4680139

hg38 chr20:4699397-4699493

t2t chr20:4738633-4738705

Details

Normal PRNP alleles have one nonapeptide followed by four octapeptide tandem repeat sequences, each of which comprises the amino acids: Pro-(His/Gln)-Gly-Gly-Gly-(-/Trp)-Gly-Gln; any additional repeat leads to pathogenicity, with the largest repeat observed at 16 motifs¹. Insertion length may correspond to phenotype, such as CJD versus frontotemporal dementia⁶. Insertions occur in the N-terminal domain, outside of the protease-resistant core that constitutes the infectious PrPSc particle⁷.

Mechanism

GoF

Insertions increase self association of the N-terminal octarepeat domain and its interaction with the adjacent polybasic tail, which is proposed to accelerate conversion of the protein to a PrPSc-like state without directly altering the amyloidogenic core^8,9. 8 or more repeats also alter copper ion coordination and increase binding affinity. This is correlated with a sharp decrease in age of onset, though it is unclear if this is causal or a correlated consequence¹⁰.

Detection

Year

1991¹¹

Location in Gene

Coding Exon 2

Gene Strand

Alleles

Ref. Motif

GGTGGTGGCTGGGGGCAGCCTCAT

Ranges

Benign (ref.)

–

Benign (gene)

–

Pathogenic (ref.)

AGCCTCATGGTGGTGGCTGGGGGC

Pathogen. (gene)

AGCCTCATGGTGGTGGCTGGGGGC

Unknown (ref.)

–

Unknown (gene)

–

Interruption (ref.)

–

Interrup. (gene)

–

gnomAD

References

Direct supporting references for info on this page.

Genetic Prion Disease

Inga,Zerr, Matthias,Schmitz

GeneReviews® · 1993-01-01

genereviews:NBK1229

Genetic Creutzfeldt–Jakob disease

Handbook of Clinical Neurology · 2018-01-01

doi:https://doi.org/10.1016/B978-0-444-63945-5.00013-1

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

4pmid:29939637

Genetic screening for Huntington disease phenocopies in Sweden: A tertiary center case series focused on short tandem repeat (STR) disorders.

Martin,Paucar, José,Laffita-Mesa, Valter,Niemelä, Helena,Malmgren, Inger,Nennesmo, Kristina,Lagerstedt-Robinson, Magnus,Nordenskjöld, Per,Svenningsson

Journal of the neurological sciences · 2023-06-10

pmid:37379724

Genetic Creutzfeldt‒Jakob disease with 5-octapeptide repeats presented as frontotemporal dementia.

Shinsuke,Hamada, Ikuko,Takahashi-Iwata, Katsuya,Satoh, Tetsuyuki,Kitamoto, Hidehiro,Mizusawa, Fumio,Moriwaka, Ichiro,Yabe

Human genome variation · 2023-03-29

pmid:36977684

Protease-sensitive prions with 144-bp insertion mutations.

Xiangzhu,Xiao, Ignazio,Cali, Zhiqian,Dong, Gianfranco,Puoti, Jue,Yuan, Liuting,Qing, Heming,Wang, Qingzhong,Kong, Pierluigi,Gambetti, Wen-Quan,Zou

Aging · 2013-03-01

pmid:23515139

The octapeptide repeats of prion protein play critical roles in the pathogenesis of prion diseases.

Xiangyi,Zhang, Jingjing,Zhang, Yan,Zhang, Dan,Wang, Gaixiu,Liu, Mengfei,Wang, Chaoyang,Li, Qi,Shi, Xiaoping,Dong, Chonggang,Yuan, Wenlong,Li, Jiyan,Ma

Acta neuropathologica communications · 2026-04-22

pmid:42021413

Octapeptide repeat insertions increase the rate of protease-resistant prion protein formation.

Roger A,Moore, Christian,Herzog, John,Errett, David A,Kocisko, Kevin M,Arnold, Stanley F,Hayes, Suzette A,Priola

Protein science : a publication of the Protein Society · 2006-02-01

pmid:16452616

Early onset prion disease from octarepeat expansion correlates with copper binding properties.

Daniel J,Stevens, Eric D,Walter, Abel,Rodríguez, David,Draper, Paul,Davies, David R,Brown, Glenn L,Millhauser

PLoS pathogens · 2009-04-17

pmid:19381258

Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene.

L G,Goldfarb, P,Brown, W R,McCombie, D,Goldgaber, G D,Swergold, P R,Wills, L,Cervenakova, H,Baron, C J,Gibbs, D C,Gajdusek

Proceedings of the National Academy of Sciences of the United States of America · 1991-12-01

pmid:1683708

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Novel polymorphisms and functional characterization of the prion protein gene in sparrows (

Chau-Giang,Truong, Da-In,Choi, Byung-Hoon,Jeong

Frontiers in veterinary science · 2026-03-11

pmid:41890154

Repeat Variants, Biomarkers, and Molecular Signatures in Parkinson's Disease:

Jose Miguel,Laffita-Mesa, Martin,Paucar, Per,Svenningsson

International journal of molecular sciences · 2025-09-20

pmid:41009775

Highly conserved prion protein sequences in random bred cats with three novel synonymous PRNP gene variants.

Canan,Güven, Iraz,Akış

Topics in companion animal medicine · 2025-08-11

pmid:40803449

Clinical, neuropathological, and molecular characteristics of rapidly progressive dementia with Lewy bodies: a distinct clinicopathological entity?

Giuseppe Mario,Bentivenga, Simone,Baiardi, Andrea,Mastrangelo, Edoardo,Ruggeri, Angela,Mammana, Alice,Ticca, Marcello,Rossi, Sabina,Capellari, Piero,Parchi

Alzheimer's research & therapy · 2024-09-10

pmid:39256877

Clinical and Molecular Findings of Intermediate Allele Carriers in the HTT Gene from the Mexican Mestizo Population.

Miguel Ángel,Ramírez-García, David José,Dávila-Ortiz de Montellano, Leticia,Martínez-Ruano, Adriana,Ochoa-Morales, Sandra,Romero-Hidalgo, Juan Carlos,Zenteno, Petra,Yescas-Gómez

Neuro-degenerative diseases · 2022-08-04

pmid:35926480

Novel Polymorphisms and Genetic Characteristics of the Prion Protein Gene in Pheasants.

Kyung Han,Kim, Yong-Chan,Kim, Byung-Hoon,Jeong

Frontiers in veterinary science · 2022-07-12

pmid:35903139

Genetic landscape of early-onset dementia in Hungary.

Dora,Csaban, Anett,Illes, Toth-Bencsik,Renata, Peter,Balicza, Klara,Pentelenyi, Viktor,Molnar, Andras,Gezsi, Zoltan,Grosz, Aniko,Gal, Tibor,Kovacs, Peter,Klivenyi, Maria Judit,Molnar

Neurological sciences : official journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology · 2022-06-25

pmid:35752680

Prion protein gene mutation detection using long-read Nanopore sequencing.

François,Kroll, Athanasios,Dimitriadis, Tracy,Campbell, Lee,Darwent, John,Collinge, Simon,Mead, Emmanuelle,Vire

Scientific reports · 2022-05-18

pmid:35585119

Co-incidental C9orf72 expansion mutation-related frontotemporal lobar degeneration pathology and sporadic Creutzfeldt-Jakob disease.

Sigrid,Klotz, Theresa,König, Marcus,Erdler, Andreas,Ulram, Anita,Nguyen, Thomas,Ströbel, Alexander,Zimprich, Elisabeth,Stögmann, Günther,Regelsberger, Romana,Höftberger, Herbert,Budka, Gabor G,Kovacs, Ellen,Gelpi

European journal of neurology · 2020-12-01

pmid:33131137

Locus CJD PRNP

Disease

Locus

Alleles

gnomAD

References

Additional Literature