CJD PRNP
Disease ID
CJD
Gene ID
PRNP
Updated
May 12, 2025
v2.4.3
v2.4.3
Disease
Name
Creutzfeldt-Jakob disease
Inheritance
Autosomal dominant Description
Locus
Details
Alleles
Ref. Motif
GGTGGTGGCTGGGGGCAGCCTCAT
Pathogenic (ref.)
CCTCATGGTGGTGGCTGGGGGCAG
Pathogenic (gene)
AGCCTCATGGTGGTGGCTGGGGGC
gnomAD
Pathogenic Genotype (%): % of individuals predicted to be affected based on their genotype
References
Direct supporting references for info on this page.
2
Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions
Stephanie E.,Wallace, Lora JH,Bean
GeneReviews® [Internet] · 2022-10-20
genereviews:NBK5351485
Genetic screening for Huntington disease phenocopies in Sweden: A tertiary center case series focused on short tandem repeat (STR) disorders.
Martin,Paucar, José,Laffita-Mesa, Valter,Niemelä, Helena,Malmgren, Inger,Nennesmo, Kristina,Lagerstedt-Robinson, Magnus,Nordenskjöld, Per,Svenningsson
Journal of the neurological sciences · 2023-06-10
pmid:373797246
Genetic Creutzfeldt‒Jakob disease with 5-octapeptide repeats presented as frontotemporal dementia.
Shinsuke,Hamada, Ikuko,Takahashi-Iwata, Katsuya,Satoh, Tetsuyuki,Kitamoto, Hidehiro,Mizusawa, Fumio,Moriwaka, Ichiro,Yabe
Human genome variation · 2023-03-29
pmid:369776847
Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications.
Indhu-Shree,Rajan-Babu, Egor,Dolzhenko, Michael A,Eberle, Jan M,Friedman
Nature reviews. Genetics · 2024-03-11
pmid:384677848
Transmissible familial Creutzfeldt-Jakob disease associated with five, seven, and eight extra octapeptide coding repeats in the PRNP gene.
L G,Goldfarb, P,Brown, W R,McCombie, D,Goldgaber, G D,Swergold, P R,Wills, L,Cervenakova, H,Baron, C J,Gibbs, D C,Gajdusek
Proceedings of the National Academy of Sciences of the United States of America · 1991-12-01
pmid:1683708Additional Literature
Additional literature related to this locus.
Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem
repeats, and disease, in medline format)
Clinical, neuropathological, and molecular characteristics of rapidly progressive dementia with Lewy bodies: a distinct clinicopathological entity?
Giuseppe Mario,Bentivenga, Simone,Baiardi, Andrea,Mastrangelo, Edoardo,Ruggeri, Angela,Mammana, Alice,Ticca, Marcello,Rossi, Sabina,Capellari, Piero,Parchi
Alzheimer's research & therapy · 2024-09-10
pmid:39256877Clinical and Molecular Findings of Intermediate Allele Carriers in the HTT Gene from the Mexican Mestizo Population.
Miguel Ángel,Ramírez-García, David José,Dávila-Ortiz de Montellano, Leticia,Martínez-Ruano, Adriana,Ochoa-Morales, Sandra,Romero-Hidalgo, Juan Carlos,Zenteno, Petra,Yescas-Gómez
Neuro-degenerative diseases · 2022-08-04
pmid:35926480Genetic landscape of early-onset dementia in Hungary.
Dora,Csaban, Anett,Illes, Toth-Bencsik,Renata, Peter,Balicza, Klara,Pentelenyi, Viktor,Molnar, Andras,Gezsi, Zoltan,Grosz, Aniko,Gal, Tibor,Kovacs, Peter,Klivenyi, Maria Judit,Molnar
Neurological sciences : official journal of the Italian Neurological Society and of the Italian Society of Clinical Neurophysiology · 2022-06-25
pmid:35752680Prion protein gene mutation detection using long-read Nanopore sequencing.
François,Kroll, Athanasios,Dimitriadis, Tracy,Campbell, Lee,Darwent, John,Collinge, Simon,Mead, Emmanuelle,Vire
Scientific reports · 2022-05-18
pmid:35585119Co-incidental C9orf72 expansion mutation-related frontotemporal lobar degeneration pathology and sporadic Creutzfeldt-Jakob disease.
Sigrid,Klotz, Theresa,König, Marcus,Erdler, Andreas,Ulram, Anita,Nguyen, Thomas,Ströbel, Alexander,Zimprich, Elisabeth,Stögmann, Günther,Regelsberger, Romana,Höftberger, Herbert,Budka, Gabor G,Kovacs, Ellen,Gelpi
European journal of neurology · 2020-12-01
pmid:33131137Absence of single nucleotide polymorphisms (SNPs) in the open reading frame (ORF) of the prion protein gene (PRNP) in a large sampling of various chicken breeds.
Yong-Chan,Kim, Sae-Young,Won, Byung-Hoon,Jeong
BMC genomics · 2019-12-03
pmid:31795947Mutation Analysis of the Genes Linked to Early Onset Alzheimer's Disease and Frontotemporal Lobar Degeneration.
Laura,Luukkainen, Seppo,Helisalmi, Laura,Kytövuori, Riitta,Ahmasalo, Eino,Solje, Annakaisa,Haapasalo, Mikko,Hiltunen, Anne M,Remes, Johanna,Krüger
Journal of Alzheimer's disease : JAD · 2019-01-01
pmid:31127772Neuropathological and genetic characteristics of a post-mortem series of cases with dementia with Lewy bodies clinically suspected of Creutzfeldt-Jakob's disease.
H,Geut, L J M,Vergouw, Y,Galis, A,Ingrassia, F J,de Jong, M,Quadri, V,Bonifati, A W,Lemstra, A J M,Rozemuller, W D J,van de Berg
Parkinsonism & related disorders · 2019-02-13
pmid:30777654