Locus NIID NOTCH2NLC
Disease ID
NIID
Gene ID
NOTCH2NLC
Updated
Jul 23, 2026
v2.24.2
v2.24.2
Other gene loci
–
Clinical Links
Bioinformatical Links
Disease
Name Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6
Inheritance
Description Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss1 . Stroke-like episodes may occur in over one third of patients and can be misdiagnosed as recurrent ischemic stroke2,3 . Often presents with gastrointestinal symptoms, including chronic refractory nausea, which preceded neurologic manifestations by decades in one documented case [pmid:41929501]. Renal, bladder, and other visceral organ involvement have been reported and may occasionally precede neurological symptoms4,5 . Subclinical peripheral neuropathy has been reported in NOTCH2NLC-related NIID6 . Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.
HPO Terms
–
Association
Mendelian
Locus
Details Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats12 . Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype13,14 : NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders15 . Age of onset inversely related to allele size16 . Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype17 . Interruptions documented: GGA, GGG18 ; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed19 . Detection may be challenging due to paralogy between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.
Mechanism Polyglycine expansion; may relate to methylation or RNA pathogenicity9,20,19 . Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation4 . The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy21 . Tau pathology is evident, changes in p-tau levels and tau deposition have been reported22 . Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression23 .
GoF
Detection
Year Year first published 201926
Location in Gene
5' UTR
Gene Strand
Alleles
Ref. Motif Reference motif, reference orientation
CGG
Ranges
Benign (ref.) Benign motif, reference orientation
–
Benign (gene) Benign motif, gene orientation
–
Pathogenic (ref.) Pathogenic motif, reference orientation
CGG
Pathogen. (gene) Pathogenic motif, gene orientation
CGG
Unknown (ref.) Unknown motif, reference orientation
–
Unknown (gene) Unknown motif, gene orientation
–
Interruption (ref.) Interruption motif, reference orientation
AGG, CAG
Interrup. (gene) Interruption motif, gene orientation
AGG, CAG
gnomAD
Pathogenic genotype frequency data is not displayed for this locus because a substantial number of large alleles failed manual review by the gnomAD team.
References
Direct supporting references for info on this page.
1
Ontology Lookup Service (OLS)
mondo:00113273
Neuronal intranuclear inclusion disease in patients with adult-onset non-vascular leukoencephalopathy.
Yi Hong,Liu, Ying Tsen,Chou, Fu Pang,Chang, Wei Ju,Lee, Yuh Cherng,Guo, Cheng Ta,Chou, Hui Chun,Huang, Takeshi,Mizuguchi, Chien Chen,Chou, Hsiang Yu,Yu, Kai Wei,Yu, Hsiu Mei,Wu, Pei Chien,Tsai, Naomichi,Matsumoto, Yi Chung,Lee, Yi Chu,Liao
Brain : a journal of neurology · 2022-09-14
pmid:354113974
Immunological characterization of neuronal intranuclear inclusion disease with kidney injury: an exploratory analysis in a multi-center cohort.
Ying,Ji, Xiaowen,Li, Jin,Tian, Xian,Chen, Guang,Ji, Maofeng,Shi, Jing,Zhang, Man,Xia, Qianru,An, Xiang,Li, Liangyu,Li, Wenjing,Song, Ruixue,Zhang, Lei,Bao, Yuqiao,Wang, Yingying,Cui, Yuyao,Tian, Hao,Chen
Frontiers in immunology · 2026-04-14
pmid:420582195
Adult-Onset Neuronal Intranuclear Inclusion Disease Initially Manifesting as Bladder Dysfunction: A Case Report.
Anna,Yamaki, Hirofumi,Sekino, Satoshi,Kawana, Ryo,Yamakuni, Shiro,Ishii, Hiroshi,Ito
Cureus · 2026-03-19
pmid:420051696
Subclinical peripheral nerve demyelination without overt symptoms in a family with neuronal intranuclear inclusion disease harboring biallelic repeat expansions.
Hang,Zhang, Taiqi,Zhao, Honglin,Zheng, Suying,Duan, Chenyang,Liu, Yaochong,Zhang, Qiang,Li, Han,Liu, Haiyang,Luo, Yuming,Xu
BMC neurology · 2026-04-18
pmid:420010027
Heterogenous Genetic, Clinical, and Imaging Features in Patients with Neuronal Intranuclear Inclusion Disease Carrying
Yusran Ady,Fitrah, Yo,Higuchi, Norikazu,Hara, Takayoshi,Tokutake, Masato,Kanazawa, Kazuhiro,Sanpei, Tomone,Taneda, Akihiko,Nakajima, Shin,Koide, Shintaro,Tsuboguchi, Midori,Watanabe, Junki,Fukumoto, Shoichiro,Ando, Tomoe,Sato, Yohei,Iwafuchi, Aki,Sato, Hideki,Hayashi, Takanobu,Ishiguro, Hayato,Takeda, Toshiaki,Takahashi, Nobuyoshi,Fukuhara, Kensaku,Kasuga, Akinori,Miyashita, Osamu,Onodera, Takeshi,Ikeuchi
Brain sciences · 2023-06-15
pmid:373714338
Neurological disorders caused by novel non-coding repeat expansions: clinical features and differential diagnosis.
Elisa,Vegezzi, Hiroyuki,Ishiura, D Cristopher,Bragg, David,Pellerin, Francesca,Magrinelli, Riccardo,Currò, Stefano,Facchini, Arianna,Tucci, John,Hardy, Nutan,Sharma, Matt C,Danzi, Stephan,Zuchner, Bernard,Brais, Mary M,Reilly, Shoji,Tsuji, Henry,Houlden, Andrea,Cortese
The Lancet. Neurology · 2024-07-01
pmid:3887675010
Clinical Features and Classification of Neuronal Intranuclear Inclusion Disease.
Hongfei,Tai, An,Wang, Yumei,Zhang, Shaocheng,Liu, Yunzhu,Pan, Kai,Li, Guixian,Zhao, Mengwen,Wang, Guode,Wu, Songtao,Niu, Hua,Pan, Bin,Chen, Wei,Li, Xingao,Wang, Gehong,Dong, Wei,Li, Ying,Zhang, Sheng,Guo, Xiaoyun,Liu, Mingxia,Li, Hui,Liang, Ming,Huang, Wei'an,Chen, Zaiqiang,Zhang
Neurology. Genetics · 2023-02-28
pmid:3709093411
Rapidly progressive adult-onset neuronal intranuclear inclusion disease beginning with autonomic symptoms: a case report.
Yi,Zhu, Qian,Yang, Yun,Tian, Weibing,Fan, Xinfa,Mao
Frontiers in neurology · 2023-05-25
pmid:3730575012
Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions
Stephanie E.,Wallace, Lora JH,Bean
GeneReviews® [Internet] · 2022-10-20
genereviews:NBK53514814
Familial adult-onset neuronal intranuclear inclusion disease: A case report and literature review.
Lijun,Wei, Jiaqi,Wang, Changming,Xu, Tengchao,Yang, Yun,Tian, Lu,Shen
Medicine · 2024-11-01
pmid:3949600515
Expansion of Human-Specific GGC Repeat in Neuronal Intranuclear Inclusion Disease-Related Disorders.
Yun,Tian, Jun-Ling,Wang, Wen,Huang, Sheng,Zeng, Bin,Jiao, Zhen,Liu, Zhao,Chen, Yujing,Li, Ying,Wang, Hao-Xuan,Min, Xue-Jing,Wang, Yong,You, Ru-Xu,Zhang, Xiao-Yu,Chen, Fang,Yi, Ya-Fang,Zhou, Hong-Yu,Long, Chao-Jun,Zhou, Xuan,Hou, Jun-Pu,Wang, Bin,Xie, Fan,Liang, Zhuan-Yi,Yang, Qi-Ying,Sun, Emily G,Allen, Andrew Mark,Shafik, Ha Eun,Kong, Ji-Feng,Guo, Xin-Xiang,Yan, Zheng-Mao,Hu, Kun,Xia, Hong,Jiang, Hong-Wei,Xu, Ran-Hui,Duan, Peng,Jin, Bei-Sha,Tang, Lu,Shen
American journal of human genetics · 2019-06-06
pmid:3117812616
Neuronal Intranuclear Inclusion Disease with NOTCH2NLC GGC Repeat Expansion: A Systematic Review and Challenges of Phenotypic Characterization.
Tian,Zeng, Yiqun,Chen, Honghao,Huang, Shengqi,Li, Jiaqi,Huang, Haobo,Xie, Shenyi,Lin, Siyao,Chen, Guangyong,Chen, Dehao,Yang
Aging and disease · 2024-01-31
pmid:3837702617
The Phenotypes and Mechanisms of NOTCH2NLC-Related GGC Repeat Expansion Disorders: a Comprehensive Review.
Xiu-Rong,Huang, Bei-Sha,Tang, Peng,Jin, Ji-Feng,Guo
Molecular neurobiology · 2021-10-31
pmid:3471896418
Comprehensive genetic diagnosis of tandem repeat expansion disorders with programmable targeted nanopore sequencing.
Igor,Stevanovski, Sanjog R,Chintalaphani, Hasindu,Gamaarachchi, James M,Ferguson, Sandy S,Pineda, Carolin K,Scriba, Michel,Tchan, Victor,Fung, Karl,Ng, Andrea,Cortese, Henry,Houlden, Carol,Dobson-Stone, Lauren,Fitzpatrick, Glenda,Halliday, Gianina,Ravenscroft, Mark R,Davis, Nigel G,Laing, Avi,Fellner, Marina,Kennerson, Kishore R,Kumar, Ira W,Deveson
Science advances · 2022-03-04
pmid:3524511019
Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications.
Indhu-Shree,Rajan-Babu, Egor,Dolzhenko, Michael A,Eberle, Jan M,Friedman
Nature reviews. Genetics · 2024-03-11
pmid:3846778420
Clinical and neuroimaging review of triplet repeat diseases.
Ryo,Kurokawa, Mariko,Kurokawa, Akihiko,Mitsutake, Moto,Nakaya, Akira,Baba, Yasuhiro,Nakata, Toshio,Moritani, Osamu,Abe
Japanese journal of radiology · 2022-09-28
pmid:3616976821
uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease.
Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong
Cell communication and signaling : CCS · 2025-02-07
pmid:3992069022
Plasma p-tau species are elevated in presymptomatic and symptomatic neuronal intranuclear inclusion disease.
Sizhe,Zhang, Bin,Jiao, Yan,Zeng, Qiying,Sun, Xiaoyu,Chen, Weiwei,Zhang, Ziyu,Ouyang, Qiao,Xiao, Lu,Zhou, Yunni,Li, Ling,Weng, Juan,Du, Qian,Xu, Yang,Yang, Mengqi,Zhang, Qiuming,Zeng, Liangjuan,Fang, Hongyu,Long, Yuanyuan,Xie, Si,Chen, Li,Feng, Qing,Huang, Lili,Long, Yafang,Zhou, Fang,Yi, Yacen,Hu, Qiong,Liu, Yongcheng,Pan, Lin,Zhou, Yulai,Li, Shuo,Hu, Jifeng,Guo, Junling,Wang, Hong,Jiang, Hongwei,Xu, Ranhui,Duan, Beisha,Tang, Yun,Tian, Lu,Shen
EBioMedicine · 2026-01-14
pmid:4153918523
ASO therapy rescues NOTCH2NLC GGC repeat expansion-induced genomic damage, 3D chromatin structural abnormalities, and senescence.
Mengjie,Li, Mibo,Tang, Xiaoyan,Hao, Zhengwei,Hu, Dongrui,Ma, Shuangjie,Li, Chunyan,Zuo, Zhiyun,Wang, Yuanyuan,Liang, Yanmei,Feng, Chenwei,Hao, Chen,Wang, Huanyu,Li, Yalan,Yang, Yuemeng,Sun, Shasha,Qi, Chengyuan,Mao, Yuming,Xu, Qun,Wang, De,Yang, Ruwei,Yang, Ziyao,Zhou, Peilin,Ji, Song,Tan, Zaiqiang,Zhang, Hao,Chen, Albert R,La Spada, Changhe,Shi
Nature communications · 2026-04-07
pmid:4194245525
Father-to-offspring transmission of extremely long NOTCH2NLC repeat expansions with contractions: genetic and epigenetic profiling with long-read sequencing.
Hiromi,Fukuda, Daisuke,Yamaguchi, Kristofor,Nyquist, Yasushi,Yabuki, Satoko,Miyatake, Yuri,Uchiyama, Kohei,Hamanaka, Ken,Saida, Eriko,Koshimizu, Naomi,Tsuchida, Atsushi,Fujita, Satomi,Mitsuhashi, Kazuyuki,Ohbo, Yuki,Satake, Jun,Sone, Hiroshi,Doi, Keisuke,Morihara, Tomoko,Okamoto, Yuji,Takahashi, Aaron M,Wenger, Norifumi,Shioda, Fumiaki,Tanaka, Naomichi,Matsumoto, Takeshi,Mizuguchi
Clinical epigenetics · 2021-11-13
pmid:3477411126
Noncoding CGG repeat expansions in neuronal intranuclear inclusion disease, oculopharyngodistal myopathy and an overlapping disease.
Hiroyuki,Ishiura, Shota,Shibata, Jun,Yoshimura, Yuta,Suzuki, Wei,Qu, Koichiro,Doi, M Asem,Almansour, Junko Kanda,Kikuchi, Makiko,Taira, Jun,Mitsui, Yuji,Takahashi, Yaeko,Ichikawa, Tatsuo,Mano, Atsushi,Iwata, Yasuo,Harigaya, Miho Kawabe,Matsukawa, Takashi,Matsukawa, Masaki,Tanaka, Yuichiro,Shirota, Ryo,Ohtomo, Hisatomo,Kowa, Hidetoshi,Date, Aki,Mitsue, Hiroyuki,Hatsuta, Satoru,Morimoto, Shigeo,Murayama, Yasushi,Shiio, Yuko,Saito, Akihiko,Mitsutake, Mizuho,Kawai, Takuya,Sasaki, Yusuke,Sugiyama, Masashi,Hamada, Gaku,Ohtomo, Yasuo,Terao, Yoshihiko,Nakazato, Akitoshi,Takeda, Yoshio,Sakiyama, Yumi,Umeda-Kameyama, Jun,Shinmi, Katsuhisa,Ogata, Yutaka,Kohno, Shen-Yang,Lim, Ai Huey,Tan, Jun,Shimizu, Jun,Goto, Ichizo,Nishino, Tatsushi,Toda, Shinichi,Morishita, Shoji,Tsuji
Nature genetics · 2019-07-22
pmid:31332380Additional Literature
Additional literature related to this locus.
Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem
repeats, and disease, in medline format)
Case Report: Neuronal intranuclear inclusion disease mimicking recurrent stroke in the setting of intracranial stenosis.
Jingmin,Zhao, Guangxun,Shen, Lumei,Chi
Frontiers in medicine · 2026-05-20
pmid:42245955Re-evaluating archival specimens as a pathologic diagnostic resource for neuronal intranuclear inclusion disease.
Yangye,Lian, Shaoping,Zhong, Jingzhen,Liang, Ke,Xu, Xin,Wang, Yuan,Ji, Jing,Ding
American journal of clinical pathology · 2026-05-05
pmid:42177789Unilateral Cortical Ribboning and Corticomedullary Lesions in a Rare Case of Coexisting Anti-N-methyl-D-aspartate Receptor Encephalitis and Neuronal Intranuclear Inclusion Disease.
Chen-Chang,Shih, Kuo-Hsuan,Chang
Acta neurologica Taiwanica · 2026-04-24
pmid:42033810A Case of Neuronal Intranuclear Inclusion Disease Mimicking Acute Stroke.
Junki,Yoshimura, Toshiyuki,Hayashi, Yu,Kashimoto, Yuki,Sakamoto, Kentaro,Suzuki, Chisato,Tamai, Jun,Sone, Satoshi,Suda
Internal medicine (Tokyo, Japan) · 2026-04-21
pmid:42021030Overflow urinary incontinence as an early manifestation of neuronal intranuclear inclusion disease (NIID): a case report.
Ming,Yang, Zhaoping,Wu, Guoyuan,Ju, Tingting,Duan
Journal of medical case reports · 2026-04-21
pmid:42015293Recurrent Bilateral Macular Edema Linked to NOTCH2NLC GGC Repeat Expansion: A Case Report.
Ruikang,Tan, Minming,Zheng, Zheng,Zheng, Caixin,Wu, Wenli,Liu, Ziyan,Xu
The American journal of case reports · 2026-04-11
pmid:41964975Neuronal intranuclear inclusion disease with initial manifestation of intractable nausea and vomiting responsive to corticosteroids: a case report.
Long,Luo, Ling,Zhu, Yong,Liang, Ying,Yuan, Lei,Chen, Weiwen,Peng, Gao,Yang, Ronghe,Yang
Frontiers in immunology · 2026-03-18
pmid:41929501Pathogenic CGG expansions in oculopharyngodistal myopathy exhibit distinct characteristics of each causative gene on the flanking sequences as well as methylation status.
Nobuyuki,Eura, Satoru,Noguchi, Megumu,Ogawa, Kyuto,Sonehara, Ai,Yamanaka, Takashi,Kurashige, Shinichiro,Hayashi, Yukinori,Okada, Kazuma,Sugie, Ichizo,Nishino
Genome medicine · 2026-03-27
pmid:41888971Clinical and imaging characteristics of NOTCH3-negative CADASIL-suspected patients with NOTCH2NLC GGC repeat expansions.
Hiraku,Matsuura, Daiki,Fukunaga, Ikuko,Mizuta, Chisato,Tamai, Rei,Yasuda, Mao,Mukai, Akiko,Watanabe-Hosomi, Takashi,Koizumi, Tomokatsu,Yoshida, Tomoyuki,Ohara, Takashi,Kasai, Jun,Sone, Toshiki,Mizuno
Journal of human genetics · 2026-03-26
pmid:41882342