NIID NOTCH2NLC

Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss¹.

Prevalence

>400 patients reported in literature². Found in individuals of East Asian ancestry³.

Age of Onset Details

Typical: 30-70⁴; Range: 10⁵- 78⁶.

Locus

hg19

chr1:145209323-145209354

hg38

chr1:149390802-149390842

t2t

chr1:148519695-148519738

Details

Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats⁷. Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype^8,9: NOTCH2NLC expansions have been linked Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders¹⁰. Age of onset inversely related to allele size¹¹. Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype¹². Interruptions documented: GGA, GGG¹³; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed¹⁴. Detection may be challenging due to parology between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.

Mechanism

GoF

Polyglycine expansion; may relate to methylation or RNA pathogenicity^4,15,14. The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy¹⁶.

Year

2019¹⁷

Gene Strand

Alleles

Ref. Motif

GGC

Pathogenic (ref.)

GGC

Pathogenic (gene)

CGG

gnomAD

Pathogenic genotype frequency data is not displayed for this locus because a substantial number of large alleles failed manual review by the gnomAD team.

References

Direct supporting references for info on this page.

Ontology Lookup Service (OLS)

mondo:0011327

Heterogenous Genetic, Clinical, and Imaging Features in Patients with Neuronal Intranuclear Inclusion Disease Carrying

Yusran Ady,Fitrah, Yo,Higuchi, Norikazu,Hara, Takayoshi,Tokutake, Masato,Kanazawa, Kazuhiro,Sanpei, Tomone,Taneda, Akihiko,Nakajima, Shin,Koide, Shintaro,Tsuboguchi, Midori,Watanabe, Junki,Fukumoto, Shoichiro,Ando, Tomoe,Sato, Yohei,Iwafuchi, Aki,Sato, Hideki,Hayashi, Takanobu,Ishiguro, Hayato,Takeda, Toshiaki,Takahashi, Nobuyoshi,Fukuhara, Kensaku,Kasuga, Akinori,Miyashita, Osamu,Onodera, Takeshi,Ikeuchi

Brain sciences · 2023-06-15

pmid:37371433

Neurological disorders caused by novel non-coding repeat expansions: clinical features and differential diagnosis.

Elisa,Vegezzi, Hiroyuki,Ishiura, D Cristopher,Bragg, David,Pellerin, Francesca,Magrinelli, Riccardo,Currò, Stefano,Facchini, Arianna,Tucci, John,Hardy, Nutan,Sharma, Matt C,Danzi, Stephan,Zuchner, Bernard,Brais, Mary M,Reilly, Shoji,Tsuji, Henry,Houlden, Andrea,Cortese

The Lancet. Neurology · 2024-07-01

pmid:38876750

omim:603472

Clinical Features and Classification of Neuronal Intranuclear Inclusion Disease.

Hongfei,Tai, An,Wang, Yumei,Zhang, Shaocheng,Liu, Yunzhu,Pan, Kai,Li, Guixian,Zhao, Mengwen,Wang, Guode,Wu, Songtao,Niu, Hua,Pan, Bin,Chen, Wei,Li, Xingao,Wang, Gehong,Dong, Wei,Li, Ying,Zhang, Sheng,Guo, Xiaoyun,Liu, Mingxia,Li, Hui,Liang, Ming,Huang, Wei'an,Chen, Zaiqiang,Zhang

Neurology. Genetics · 2023-02-28

pmid:37090934

Rapidly progressive adult-onset neuronal intranuclear inclusion disease beginning with autonomic symptoms: a case report.

Yi,Zhu, Qian,Yang, Yun,Tian, Weibing,Fan, Xinfa,Mao

Frontiers in neurology · 2023-05-25

pmid:37305750

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

Erratum: Prevalence and Characterization of

Neurology. Genetics · 2024-07-12

pmid:39055960

Familial adult-onset neuronal intranuclear inclusion disease: A case report and literature review.

Lijun,Wei, Jiaqi,Wang, Changming,Xu, Tengchao,Yang, Yun,Tian, Lu,Shen

Medicine · 2024-11-01

pmid:39496005

Expansion of Human-Specific GGC Repeat in Neuronal Intranuclear Inclusion Disease-Related Disorders.

Yun,Tian, Jun-Ling,Wang, Wen,Huang, Sheng,Zeng, Bin,Jiao, Zhen,Liu, Zhao,Chen, Yujing,Li, Ying,Wang, Hao-Xuan,Min, Xue-Jing,Wang, Yong,You, Ru-Xu,Zhang, Xiao-Yu,Chen, Fang,Yi, Ya-Fang,Zhou, Hong-Yu,Long, Chao-Jun,Zhou, Xuan,Hou, Jun-Pu,Wang, Bin,Xie, Fan,Liang, Zhuan-Yi,Yang, Qi-Ying,Sun, Emily G,Allen, Andrew Mark,Shafik, Ha Eun,Kong, Ji-Feng,Guo, Xin-Xiang,Yan, Zheng-Mao,Hu, Kun,Xia, Hong,Jiang, Hong-Wei,Xu, Ran-Hui,Duan, Peng,Jin, Bei-Sha,Tang, Lu,Shen

American journal of human genetics · 2019-06-06

pmid:31178126

Neuronal Intranuclear Inclusion Disease with NOTCH2NLC GGC Repeat Expansion: A Systematic Review and Challenges of Phenotypic Characterization.

Tian,Zeng, Yiqun,Chen, Honghao,Huang, Shengqi,Li, Jiaqi,Huang, Haobo,Xie, Shenyi,Lin, Siyao,Chen, Guangyong,Chen, Dehao,Yang

Aging and disease · 2024-02-16

pmid:38377026

The Phenotypes and Mechanisms of NOTCH2NLC-Related GGC Repeat Expansion Disorders: a Comprehensive Review.

Xiu-Rong,Huang, Bei-Sha,Tang, Peng,Jin, Ji-Feng,Guo

Molecular neurobiology · 2021-10-31

pmid:34718964

Comprehensive genetic diagnosis of tandem repeat expansion disorders with programmable targeted nanopore sequencing.

Igor,Stevanovski, Sanjog R,Chintalaphani, Hasindu,Gamaarachchi, James M,Ferguson, Sandy S,Pineda, Carolin K,Scriba, Michel,Tchan, Victor,Fung, Karl,Ng, Andrea,Cortese, Henry,Houlden, Carol,Dobson-Stone, Lauren,Fitzpatrick, Glenda,Halliday, Gianina,Ravenscroft, Mark R,Davis, Nigel G,Laing, Avi,Fellner, Marina,Kennerson, Kishore R,Kumar, Ira W,Deveson

Science advances · 2022-03-04

pmid:35245110

Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications.

Indhu-Shree,Rajan-Babu, Egor,Dolzhenko, Michael A,Eberle, Jan M,Friedman

Nature reviews. Genetics · 2024-03-11

pmid:38467784

Clinical and neuroimaging review of triplet repeat diseases.

Ryo,Kurokawa, Mariko,Kurokawa, Akihiko,Mitsutake, Moto,Nakaya, Akira,Baba, Yasuhiro,Nakata, Toshio,Moritani, Osamu,Abe

Japanese journal of radiology · 2022-09-28

pmid:36169768

uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease

Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong

Cell Communication and Signaling · 2025-02-07

doi:10.1186/s12964-025-02079-1

Noncoding CGG repeat expansions in neuronal intranuclear inclusion disease, oculopharyngodistal myopathy and an overlapping disease.

Hiroyuki,Ishiura, Shota,Shibata, Jun,Yoshimura, Yuta,Suzuki, Wei,Qu, Koichiro,Doi, M Asem,Almansour, Junko Kanda,Kikuchi, Makiko,Taira, Jun,Mitsui, Yuji,Takahashi, Yaeko,Ichikawa, Tatsuo,Mano, Atsushi,Iwata, Yasuo,Harigaya, Miho Kawabe,Matsukawa, Takashi,Matsukawa, Masaki,Tanaka, Yuichiro,Shirota, Ryo,Ohtomo, Hisatomo,Kowa, Hidetoshi,Date, Aki,Mitsue, Hiroyuki,Hatsuta, Satoru,Morimoto, Shigeo,Murayama, Yasushi,Shiio, Yuko,Saito, Akihiko,Mitsutake, Mizuho,Kawai, Takuya,Sasaki, Yusuke,Sugiyama, Masashi,Hamada, Gaku,Ohtomo, Yasuo,Terao, Yoshihiko,Nakazato, Akitoshi,Takeda, Yoshio,Sakiyama, Yumi,Umeda-Kameyama, Jun,Shinmi, Katsuhisa,Ogata, Yutaka,Kohno, Shen-Yang,Lim, Ai Huey,Tan, Jun,Shimizu, Jun,Goto, Ichizo,Nishino, Tatsushi,Toda, Shinichi,Morishita, Shoji,Tsuji

Nature genetics · 2019-07-22

pmid:31332380

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Generation of an induced pluripotent stem cell line (PNUYHi003-A) from peripheral blood mononuclear cells of a patient with neuronal intranuclear inclusion disease.

Tae-Yun,Kim, Mi Kyoung,Kim, Takeshi,Mizuguchi, Naomichi,Matsumoto, Jae-Hyeok,Lee, Eun-Joo,Kim, Na-Yeon,Jung

Stem cell research · 2025-04-16

pmid:40267536

A case report of oculopharyngodistal myopathy with 126 CGG repeat expansions in

Wenjing,Wang, Tielun,Yin, Xinyu,Zhang, Zhaoxia,Wang, Tianyun,Wang, Shuo,Zhang, Yingshuang,Zhang, Dongsheng,Fan

Frontiers in genetics · 2025-02-27

pmid:40084170

Heat-shock chaperone HSPB1 mitigates poly-glycine-induced neurodegeneration via restoration of autophagic flux.

Ning,Ding, Yijie,Song, Yuhang,Zhang, Wei,Yu, Xinnan,Li, Wei,Li, Lei,Li

Autophagy · 2025-02-25

pmid:39936620

uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease.

Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong

Cell communication and signaling : CCS · 2025-02-07

pmid:39920690

NOTCH2NLC GGC intermediate repeat with serine induces hypermyelination and early Parkinson's disease-like phenotypes in mice.

Haitao,Tu, Xin Yi,Yeo, Zhi-Wei,Zhang, Wei,Zhou, Jayne Yi,Tan, Li,Chi, Sook-Yoong,Chia, Zhihong,Li, Aik Yong,Sim, Brijesh Kumar,Singh, Dongrui,Ma, Zhidong,Zhou, Isabelle,Bonne, Shuo-Chien,Ling, Adeline S L,Ng, Sangyong,Jung, Eng-King,Tan, Li,Zeng

Molecular neurodegeneration · 2024-11-28

pmid:39609868

Neuronal Intranuclear Inclusion Disease Presenting with Acute-Onset Dementia and Cortical Edema: A Case Report.

Xiao,Feng, Yue,Li, Qin,Zhao, Shabei,Xu

Frontiers in neurology · 2024-10-28

pmid:39529621

CGG Repeat Expansion in

Jing,Ma, Huiqiu,Zhang, Bing,Meng, Jiangbo,Qin, Hongye,Liu, Xiaomin,Pang, Rongjuan,Zhao, Juan,Wang, Xueli,Chang, Junhong,Guo, Wei,Zhang

Journal of clinical neurology (Seoul, Korea) · 2024-11-01

pmid:39505310

dmTGS: Precise Targeted Enrichment Long-Read Sequencing Panel for Tandem Repeat Detection.

Kang,Yang, Yue,Liu, Ji,Zhang, Qian,Yu, Feng,Xu, Jiyuan,Liu, Yuting,Li, Xiaojie,Zhang, Zhiqiang,Wang, Ning,Wang, Yuezhen,Li, Yan,Shi, Wan-Jin,Chen

Clinical chemistry · 2025-02-03

pmid:39492694

Sequential development of parkinsonism in two patients with oculopharyngodistal type myopathy in GIPC1-related repeat expansion disorder.

Aki,Murayama, Utako,Nagaoka, Keizo,Sugaya, Rui,Shimazaki, Kazuhito,Miyamoto, Shiro,Matsubara, Masashi,Ogasawara, Aritoshi,Iida, Ichizo,Nishino, Kazushi,Takahashi

Neuromuscular disorders : NMD · 2024-09-27

pmid:39418922