Locus RCPS EIF4A3

Richieri Costa-Pereira syndrome is characterized by short stature, Robin sequence, cleft mandible, pre/postaxial hand anomalies (including hypoplastic thumbs), and clubfoot. It has been described in 14 Brazilian families and in one unrelated French patient. Prominent low set ears and a highly arched palate were also observed. Transmission is autosomal recessive¹.

Prevalence

49 cases as of Nov 2023². Found in Brazilian families and one unrelated French patient¹.

Age of Onset

0 (birth)

HPO Terms

HP:0000160 Narrow mouth HP:0000175 Cleft palate HP:0000193 Bifid uvula HP:0000201 Pierre-Robin sequence HP:0000218 High palate HP:0000308 Microretrognathia HP:0000347 Micrognathia HP:0000369 Low-set ears HP:0000377 Abnormal pinna morphology HP:0000411 Protruding ear HP:0000448 Prominent nose HP:0000690 Agenesis of maxillary lateral incisor HP:0000750 Delayed speech and language development HP:0001245 Small thenar eminence HP:0001263 Global developmental delay HP:0001328 Specific learning disability HP:0001608 Abnormality of the voice HP:0001609 Hoarse voice HP:0001762 Talipes equinovarus HP:0002643 Neonatal respiratory distress HP:0002827 Hip dislocation HP:0002984 Hypoplasia of the radius HP:0003038 Fibular hypoplasia HP:0004209 Clinodactyly of the 5th finger HP:0004322 Short stature HP:0004987 Mesomelic leg shortening HP:0005011 Mesomelic arm shortening HP:0005736 Short tibia HP:0005867 4-5 metacarpal synostosis HP:0006355 Agenesis of mandibular central incisor HP:0006536 Airway obstruction HP:0008744 Abnormal aryepiglottic fold morphology HP:0008753 Aplasia of the epiglottis HP:0008807 Acetabular dysplasia HP:0008872 Feeding difficulties in infancy HP:0009094 Cleft lower alveolar ridge HP:0009237 Short 5th finger HP:0009486 Radial deviation of the hand HP:0009601 Aplasia/Hypoplasia of the thumb HP:0009623 Proximal placement of thumb HP:0009778 Short thumb HP:0009803 Short phalanx of finger HP:0010049 Short metacarpal HP:0010109 Short hallux HP:0010487 Small hypothenar eminence HP:0010565 Aplasia/Hypoplasia of the Epiglottis HP:0010752 Cleft mandible HP:0011051 Agenesis of premolar HP:0011968 Feeding difficulties HP:0012789 Hypoplasia of the calcaneus HP:0030043 Hip subluxation HP:0100499 Tibial deviation of toes HP:0200154 Agenesis of mandibular lateral incisor

Association

Mendelian

Locus

hg19 chr17:78120808-78120938

hg38 chr17:80147009-80147139

t2t chr17:81047404-81047534

Details

Complex repeat of 18-20 nucleotides expands to cause disease: disease is found in individuals with 14-16 repeats³, while controls have typically 3-12 repeats with as low as 1 repeat^4,5. Significance of intermediate alleles is unknown⁶.

Mechanism

LoF

LoF from a hypomorphic allele³.

Detection

Short-read sequencing and exome sequencing do not reliably detect this expansion. Targeted 5' UTR PCR with Sanger sequencing is the common detection methodology^6,3.

Year

2014³; syndrome described in 1992⁷

Location in Gene

5' UTR

Gene Strand

Alleles

Ref. Motif

CCTCGCTGTGCCGCTGCCGA

Ranges

Benign (ref.)

–

Benign (gene)

–

Pathogenic (ref.)

GCCGCTGCCGACCTCGCTGT

Pathogen. (gene)

ACAGCGAGGTCGGCAGCGGC

Unknown (ref.)

–

Unknown (gene)

–

Interruption (ref.)

–

Interrup. (gene)

–

gnomAD

References

Direct supporting references for info on this page.

Ontology Lookup Service (OLS)

mondo:0009998

Treatment of the median mandibular cleft in Richieri-Costa-Pereira syndrome with a customized total mandibular prosthesis: A case report

Ryuichi,Hoshi, Paula,Marcella Silva Drago, Henrique,Mascarenhas Villela, Gabriela,Gayer Sheibler, Daniel,Serra Cassano, Fernanda,Barros Silva de Pedreira Barbosa, Lissa,Hoshi, Isadora,dos Santos Lima

Oral and Maxillofacial Surgery Cases · 2024-03-01

doi:10.1016/j.omsc.2023.100340

A noncoding expansion in EIF4A3 causes Richieri-Costa-Pereira syndrome, a craniofacial disorder associated with limb defects.

Francine P,Favaro, Lucas,Alvizi, Roseli M,Zechi-Ceide, Debora,Bertola, Temis M,Felix, Josiane,de Souza, Salmo,Raskin, Stephen R F,Twigg, Andrea M J,Weiner, Pablo,Armas, Ezequiel,Margarit, Nora B,Calcaterra, Gregers R,Andersen, Simon J,McGowan, Andrew O M,Wilkie, Antonio,Richieri-Costa, Maria L G,de Almeida, Maria Rita,Passos-Bueno

American journal of human genetics · 2013-12-19

pmid:24360810

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

gnomAD

gnomad:EIF4A3

Richieri-Costa-Pereira syndrome: Expanding its phenotypic and genotypic spectrum.

D R,Bertola, G,Hsia, L,Alvizi, A,Gardham, E L,Wakeling, G L,Yamamoto, R S,Honjo, L A N,Oliveira, R C,Di Francesco, B A,Perez, C A,Kim, M R,Passos-Bueno

Clinical genetics · 2018-02-20

pmid:29112243

Short stature, Robin sequence, cleft mandible, pre/postaxial hand anomalies, and clubfoot: a new autosomal recessive syndrome.

A,Richieri-Costa, S C,Pereira

American journal of medical genetics · 1992-03-01

pmid:1632438

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)