Locus ADTKD MUC1
Suggest EditDisease
–
Name Autosomal dominant tubulointerstitial kidney disease
Inheritance
Description An inherited disorder that causes a gradual loss of kidney function, caused by a mutation in the MUC1 gene that leads to production of an abnormal mucin 1 protein, which deposits in the kidney and leads to slow loss of kidney function1 .
Prevalence Disease affects 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsible for 95% of disease2 .
2.5 1,000,000
Age of Onset
HPO Terms
HP:0000089 Renal hypoplasiaHP:0000092 Renal tubular atrophyHP:0000096 Glomerular sclerosisHP:0000108 Renal corticomedullary cystsHP:0000127 Renal salt wastingHP:0000822 HypertensionHP:0001903 AnemiaHP:0001970 Tubulointerstitial nephritisHP:0001997 GoutHP:0002048 Renal cortical atrophyHP:0002120 Cerebral cortical atrophyHP:0002149 HyperuricemiaHP:0002615 HypotensionHP:0003259 Elevated circulating creatinine concentrationHP:0003774 Stage 5 chronic kidney diseaseHP:0004732 Impaired renal uric acid clearanceHP:0005576 Tubulointerstitial fibrosisHP:0005583 Tubular basement membrane disintegrationHP:0012213 Decreased glomerular filtration rate
Association
Mendelian
Locus
Details Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract (i.e. from (C)7 to (C)8) within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family4 . NOTE: Disease is caused by a 7 to 8 C homopolymer expansion within the main motif which we represent here as a change in motif. A de novo occurrence has been confirmed with parental testing5 .
Mechanism Toxic protein product accumulates in kidneys2 .
GoF
Detection This locus is particularly difficult to genotype6,7 . Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40-83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant8 . Exome sequencing, short-read sequencing, and Sanger sequencing do not reliably detect these variants2 . Targeted long-read amplicon sequencing with dedicated VNTR reconstruction software can phase both haplotypes and detect atypical variants, including in sporadic cases5,2,9 .
Year Year first published 20136
Location in Gene
Coding Exon 2
Gene Strand
Alleles
Ref. Motif Reference motif, reference orientation
GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG
Ranges
Benign (ref.) Benign motif, reference orientation
CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGCGGTGGAGCCCGGGGCCGGCCTGGTGT
Benign (gene) Benign motif, gene orientation
ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG
Pathogenic (ref.) Pathogenic motif, reference orientation
CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCCTGGTGT
Pathogen. (gene) Pathogenic motif, gene orientation
ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG
Unknown (ref.) Unknown motif, reference orientation
–
Unknown (gene) Unknown motif, gene orientation
–
Interruption (ref.) Interruption motif, reference orientation
–
Interrup. (gene) Interruption motif, gene orientation
–
References
Direct supporting references for info on this page.
1
Ontology Lookup Service (OLS)
mondo:00207262
Autosomal Dominant Tubulointerstitial Kidney Disease – MUC1
Anthony J.,Bleyer, Martina,Živná, Kendrah,Kidd, Stanislav,Kmoch
GeneReviews® · 1993-01-01
genereviews:NBK1537233
Long-Read Sequencing of the
Alena,Vrbacká, Anna,Přistoupilová, Kendrah O,Kidd, Václav,Janoušek, Martin,Radina, Petr,Vyleťal, Ibrahim,Bitar, Viktor,Stránecký, Lenka,Steiner-Mrázová, Helena,Trešlová, Jana,Sovová, Kateřina,Hodaňová, Hana,Hartmannová, Dita,Mušálková, Klára,Svojšová, Tereza,Kmochová, Veronika,Barešová, Abby,Taylor, Lauren,Martin, Antonio,Sanchez, Romana,Ryšavá, Innet,Lajtmanová, Silvie,Rajnochová-Bloudíčková, Ondřej,Viklický, Gregorius,Papagregorius, Constantinos,Deltas, Christoforos,Stavrou, Sofia,Jorge, José António,Lopes, Márcia,Rodrigues, Elhussein,Elhassan, Michelle,Clince, Colm,Rowan, Peter,Conlon, Omri,Teltsh, Gianpiero L,Cavalleri, Brendan,Blumenstiel, Diana,Toledo, Marina,DiStefano, Matthew,DeFelice, Martina,Živná, Anthony J,Bleyer, Stanislav,Kmoch
bioRxiv : the preprint server for biology · 2025-09-16
pmid:410008834
Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions
Stephanie E.,Wallace, Lora JH,Bean
GeneReviews® [Internet] · 2022-10-20
genereviews:NBK5351485
Targeted VNTR long read sequencing resolves a diagnostic bottleneck in ADTKD and detects de novo ADTKD-MUC1.
Andrea,Wenzel, Björn,Reusch, Karl X,Knaup, Nikola,Zagorec, Margareta Fistrek,Prlic, Kerstin,Becker, Vera,Riehmer, Roman-U,Müller, Francesca,Pasutto, Julia,Hoefele, Michael S,Wiesener, Bruno,Huettel, Florian,Erger, Bodo B,Beck
Kidney international · 2026-07-24
pmid:424980606
Mutations causing medullary cystic kidney disease type 1 lie in a large VNTR in MUC1 missed by massively parallel sequencing.
Andrew,Kirby, Andreas,Gnirke, David B,Jaffe, Veronika,Barešová, Nathalie,Pochet, Brendan,Blumenstiel, Chun,Ye, Daniel,Aird, Christine,Stevens, James T,Robinson, Moran N,Cabili, Irit,Gat-Viks, Edward,Kelliher, Riza,Daza, Matthew,DeFelice, Helena,Hůlková, Jana,Sovová, Petr,Vylet'al, Corinne,Antignac, Mitchell,Guttman, Robert E,Handsaker, Danielle,Perrin, Scott,Steelman, Snaevar,Sigurdsson, Steven J,Scheinman, Carrie,Sougnez, Kristian,Cibulskis, Melissa,Parkin, Todd,Green, Elizabeth,Rossin, Michael C,Zody, Ramnik J,Xavier, Martin R,Pollak, Seth L,Alper, Kerstin,Lindblad-Toh, Stacey,Gabriel, P Suzanne,Hart, Aviv,Regev, Chad,Nusbaum, Stanislav,Kmoch, Anthony J,Bleyer, Eric S,Lander, Mark J,Daly
Nature genetics · 2013-02-10
pmid:233961337
Jeff,Granhøj, Dorte L,Lildballe, Katja V,Pedersen, Birgitte G,Tougaard, Martin,Sokol, Mads M,Aagaard, Annabeth H,Petersen, Tilde,Kristensen, Malene,Djursby, Henrik,Birn, Maria,Rasmussen
Clinical kidney journal · 2024-11-18
pmid:397814759
Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations.
Andrea,Wenzel, Janine,Altmueller, Arif B,Ekici, Bernt,Popp, Kurt,Stueber, Holger,Thiele, Alois,Pannes, Simon,Staubach, Eduardo,Salido, Peter,Nuernberg, Richard,Reinhardt, André,Reis, Patrick,Rump, Franz-Georg,Hanisch, Matthias T F,Wolf, Michael,Wiesener, Bruno,Huettel, Bodo B,Beck
Scientific reports · 2018-03-08
pmid:29520014Additional Literature
Additional literature related to this locus.
Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem
repeats, and disease, in medline format)
Targeted VNTR long read sequencing resolves a diagnostic bottleneck in ADTKD and detects de novo ADTKD-MUC1.
Andrea,Wenzel, Björn,Reusch, Karl X,Knaup, Nikola,Zagorec, Margareta Fistrek,Prlic, Kerstin,Becker, Vera,Riehmer, Roman-U,Müller, Francesca,Pasutto, Julia,Hoefele, Michael S,Wiesener, Bruno,Huettel, Florian,Erger, Bodo B,Beck
Kidney international · 2026-07-24
pmid:42498060Complex structural variation, phylogeny, and disease associations of the mucin pangenome.
Elizabeth G,Plender, Timofey,Prodanov, Jiadong,Lin, Isaac,Wong, Julie,Wertz, William W,Gordon, Michael J,Bamshad, Katherine M,Munson, Wanda K,O'Neal, Jesse D,Bloom, Tobias,Marschall, Evan E,Eichler
medRxiv : the preprint server for health sciences · 2026-07-04
pmid:42428052Establishment and Molecular Characterization of a Short-Term Primary Culture Derived From Invasive Micropapillary Carcinoma of the Breast.
Mamta,Gurav, Omshree,Shetty, Shalaka,Joshi, Seema,Gulia, Rohan,Chaubal, Sudeep,Gupta, Tanuja,Shet
Cell biology international · 2026-06-01
pmid:42175825Single-Molecule Real-Time Sequencing for MUC1 Variable Number of Tandem Repeat Variation to Improve Autosomal Dominant Tubulointerstitial Kidney Disease Diagnosis.
Alena,Vrbacká, Anna,Přistoupilová, Kendrah O,Kidd, Václav,Janoušek, Martin,Radina, Petr,Vylet'al, Ibrahim,Bitar, Viktor,Stránecký, Lenka,Steiner-Mrázová, Helena,Trešlová, Jana,Sovová, Kateřina,Hodaňová, Hana,Hartmannová, Dita,Mušálková, Klára,Svojšová, Tereza,Kmochová, Veronika,Barešová, Heidi,Bleyer, Abby,Taylor, Lauren,Martin, Antonio,Sanchez, Romana,Ryšavá, Innet,Lajtmanová, Silvie,Rajnochová-Bloudíčková, Ondřej,Viklický, Gregory,Papagregoriou, Constantinos,Deltas, Christoforos,Stavrou, Sofia,Jorge, José António,Lopes, Márcia,Rodrigues, Elhussein,Elhassan, Michelle,Clince, Colm,Rowan, Peter,Conlon, Omri,Teltsh, Gianpiero L,Cavalleri, Brendan,Blumenstiel, Diana,Toledo, Marina,DiStefano, Matthew,DeFelice, Martina,Živná, Anthony J,Bleyer, Stanislav,Kmoch
Journal of the American Society of Nephrology : JASN · 2026-04-10
pmid:41961547Inhibition of endocytosis by glycans arises from steric rather than electrostatic repulsion.
Advika,Kamatar, Jose A,Villalobos, Carl C,Hayden, Fabiola G,Rodriguez Flores, Stephanie,Archer-Hartmann, Parastoo,Azadi, Brian,Belardi, Sapun H,Parekh, Jeanne C,Stachowiak
Biophysical journal · 2026-03-13
pmid:41832605Analysis of clinically relevant large tandem repeats using nanopore sequencing.
Silvia,Madritsch, David,Horner, Tamara,Löwenstern, Nadja,Brait, Vivienne,Arnold, Andrea,Wenzel, Denisa,Weis, Markus,Hengstschläger, Franco,Laccone
Scientific reports · 2025-12-04
pmid:41345522Clinical use of the VNtyper-Kestrel pipeline for MUC1 variant detection in autosomal-dominant tubulointerstitial kidney disease.
China,Nagano, Naoya,Morisada, Yuta,Inoki, Yu,Tanaka, Yuta,Ichikawa, Chika,Ueda, Hideaki,Kitakado, Yuya,Aoto, Nana,Sakakibara, Tomoko,Horinouchi, Tomohiko,Yamamura, Shingo,Ishimori, Kandai,Nozu
Clinical and experimental nephrology · 2025-04-17
pmid:40244446Phenotypic Heterogeneity of ADTKD-MUC1 Diagnosed Using VNtyper, a Novel Genetic Technique.
Jessica,Kachmar, Hassan,Saei, Vincent,Morinière, Laurence,Heidet, Bertrand,Knebelmann, Olivier,Gribouval, Manon,Mautret-Godefroy, Stéphane,Burtey, Vincent,Vuiblet, Asma,Alla, Axel,Ibalanky, Olivier,Moranne, Mathilde,Nizon, Benjamin,Savenkoff, Patrick,Nitschké, Corinne,Antignac, Guillaume,Dorval
American journal of kidney diseases : the official journal of the National Kidney Foundation · 2025-01-22
pmid:39848530Jeff,Granhøj, Dorte L,Lildballe, Katja V,Pedersen, Birgitte G,Tougaard, Martin,Sokol, Mads M,Aagaard, Annabeth H,Petersen, Tilde,Kristensen, Malene,Djursby, Henrik,Birn, Maria,Rasmussen
Clinical kidney journal · 2024-11-18
pmid:39781475