Locus ADTKD MUC1

An inherited disorder that causes a gradual loss of kidney function, caused by a mutation in the MUC1 gene that leads to production of an abnormal mucin 1 protein, which deposits in the kidney and leads to slow loss of kidney function¹.

Prevalence

2.5 1,000,000

Disease affects 1-4/1,000,000 (likely an underestimate due to unremarkable findings); repeat expansion responsible for 95% of disease².

Age of Onset

Age of onset for end-stage renal disease (the only systemic manifestation) ranges from 16³-70².

HPO Terms

HP:0000089 Renal hypoplasia HP:0000092 Renal tubular atrophy HP:0000096 Glomerular sclerosis HP:0000108 Renal corticomedullary cysts HP:0000127 Renal salt wasting HP:0000822 Hypertension HP:0001903 Anemia HP:0001970 Tubulointerstitial nephritis HP:0001997 Gout HP:0002048 Renal cortical atrophy HP:0002120 Cerebral cortical atrophy HP:0002149 Hyperuricemia HP:0002615 Hypotension HP:0003259 Elevated circulating creatinine concentration HP:0003774 Stage 5 chronic kidney disease HP:0004732 Impaired renal uric acid clearance HP:0005576 Tubulointerstitial fibrosis HP:0005583 Tubular basement membrane disintegration HP:0012213 Decreased glomerular filtration rate

Association

Mendelian

Locus

hg19 chr1:155160981-155162030

hg38 chr1:155188505-155192239

t2t chr1:154328121-154330802

Details

Disease is caused by the single base expansion of a heptanucleotide (7) cytosine homopolymer tract (i.e. from (C)7 to (C)8) within one copy of a coding VNTR, resulting in a frameshift mutation. This VNTR has a 60 bp motif, varying in length and sequence composition. This motif ranges in copy number from 20-125 (~1.5-5 kb) and is GC-rich (>80%). The specific copy of the VNTR motif involved varies by family but is consistent within a family⁴. NOTE: Disease is caused by a 7 to 8 C homopolymer expansion within the main motif which we represent here as a change in motif. A de novo occurrence has been confirmed with parental testing⁵.

Mechanism

GoF

Toxic protein product accumulates in kidneys².

Detection

This locus is particularly difficult to genotype^6,7. Gamaarachchi et al. observed 20 unique VNTR haplotypes which ranged in size from 40-83 copies, with no unrelated individuals sharing the same haplotype. Unique haplotypes implied frequent independent origins of the dupC variant⁸. Exome sequencing, short-read sequencing, and Sanger sequencing do not reliably detect these variants². Targeted long-read amplicon sequencing with dedicated VNTR reconstruction software can phase both haplotypes and detect atypical variants, including in sporadic cases^5,2,9.

Year

2013⁶

Location in Gene

Coding Exon 2

Gene Strand

Alleles

Ref. Motif

GGCTNNGGGNGCGGTGGAGCCCGGGGCNGGNCTGNTNTCCGGGGCCGAGGTGACANCNTG

Ranges

Benign (ref.)

CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGCGGTGGAGCCCGGGGCCGGCCTGGTGT

Benign (gene)

ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG

Pathogenic (ref.)

CCGGGGCCGAGGTGACACCGTGGGCTGGGGGGGGCGGTGGAGCCCGGGGCCGGCCTGGTGT

Pathogen. (gene)

ACACCAGGCCGGCCCCGGGCTCCACCGCCCCCCCCAGCCCACGGTGTCACCTCGGCCCCGG

Unknown (ref.)

–

Unknown (gene)

–

Interruption (ref.)

–

Interrup. (gene)

–

References

Direct supporting references for info on this page.

Ontology Lookup Service (OLS)

mondo:0020726

Autosomal Dominant Tubulointerstitial Kidney Disease – MUC1

Anthony J.,Bleyer, Martina,Živná, Kendrah,Kidd, Stanislav,Kmoch

GeneReviews® · 1993-01-01

genereviews:NBK153723

Long-Read Sequencing of the

Alena,Vrbacká, Anna,Přistoupilová, Kendrah O,Kidd, Václav,Janoušek, Martin,Radina, Petr,Vyleťal, Ibrahim,Bitar, Viktor,Stránecký, Lenka,Steiner-Mrázová, Helena,Trešlová, Jana,Sovová, Kateřina,Hodaňová, Hana,Hartmannová, Dita,Mušálková, Klára,Svojšová, Tereza,Kmochová, Veronika,Barešová, Abby,Taylor, Lauren,Martin, Antonio,Sanchez, Romana,Ryšavá, Innet,Lajtmanová, Silvie,Rajnochová-Bloudíčková, Ondřej,Viklický, Gregorius,Papagregorius, Constantinos,Deltas, Christoforos,Stavrou, Sofia,Jorge, José António,Lopes, Márcia,Rodrigues, Elhussein,Elhassan, Michelle,Clince, Colm,Rowan, Peter,Conlon, Omri,Teltsh, Gianpiero L,Cavalleri, Brendan,Blumenstiel, Diana,Toledo, Marina,DiStefano, Matthew,DeFelice, Martina,Živná, Anthony J,Bleyer, Stanislav,Kmoch

bioRxiv : the preprint server for biology · 2025-09-16

pmid:41000883

Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions

Stephanie E.,Wallace, Lora JH,Bean

GeneReviews® [Internet] · 2022-10-20

genereviews:NBK535148

Targeted VNTR long read sequencing resolves a diagnostic bottleneck in ADTKD and detects de novo ADTKD-MUC1.

Andrea,Wenzel, Björn,Reusch, Karl X,Knaup, Nikola,Zagorec, Margareta Fistrek,Prlic, Kerstin,Becker, Vera,Riehmer, Roman-U,Müller, Francesca,Pasutto, Julia,Hoefele, Michael S,Wiesener, Bruno,Huettel, Florian,Erger, Bodo B,Beck

Kidney international · 2026-07-24

pmid:42498060

Mutations causing medullary cystic kidney disease type 1 lie in a large VNTR in MUC1 missed by massively parallel sequencing.

Andrew,Kirby, Andreas,Gnirke, David B,Jaffe, Veronika,Barešová, Nathalie,Pochet, Brendan,Blumenstiel, Chun,Ye, Daniel,Aird, Christine,Stevens, James T,Robinson, Moran N,Cabili, Irit,Gat-Viks, Edward,Kelliher, Riza,Daza, Matthew,DeFelice, Helena,Hůlková, Jana,Sovová, Petr,Vylet'al, Corinne,Antignac, Mitchell,Guttman, Robert E,Handsaker, Danielle,Perrin, Scott,Steelman, Snaevar,Sigurdsson, Steven J,Scheinman, Carrie,Sougnez, Kristian,Cibulskis, Melissa,Parkin, Todd,Green, Elizabeth,Rossin, Michael C,Zody, Ramnik J,Xavier, Martin R,Pollak, Seth L,Alper, Kerstin,Lindblad-Toh, Stacey,Gabriel, P Suzanne,Hart, Aviv,Regev, Chad,Nusbaum, Stanislav,Kmoch, Anthony J,Bleyer, Eric S,Lander, Mark J,Daly

Nature genetics · 2013-02-10

pmid:23396133

Jeff,Granhøj, Dorte L,Lildballe, Katja V,Pedersen, Birgitte G,Tougaard, Martin,Sokol, Mads M,Aagaard, Annabeth H,Petersen, Tilde,Kristensen, Malene,Djursby, Henrik,Birn, Maria,Rasmussen

Clinical kidney journal · 2024-11-18

pmid:39781475

8pmid:41285770

Single molecule real time sequencing in ADTKD-MUC1 allows complete assembly of the VNTR and exact positioning of causative mutations.

Andrea,Wenzel, Janine,Altmueller, Arif B,Ekici, Bernt,Popp, Kurt,Stueber, Holger,Thiele, Alois,Pannes, Simon,Staubach, Eduardo,Salido, Peter,Nuernberg, Richard,Reinhardt, André,Reis, Patrick,Rump, Franz-Georg,Hanisch, Matthias T F,Wolf, Michael,Wiesener, Bruno,Huettel, Bodo B,Beck

Scientific reports · 2018-03-08

pmid:29520014

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Targeted VNTR long read sequencing resolves a diagnostic bottleneck in ADTKD and detects de novo ADTKD-MUC1.

Kidney international · 2026-07-24

pmid:42498060

Complex structural variation, phylogeny, and disease associations of the mucin pangenome.

Elizabeth G,Plender, Timofey,Prodanov, Jiadong,Lin, Isaac,Wong, Julie,Wertz, William W,Gordon, Michael J,Bamshad, Katherine M,Munson, Wanda K,O'Neal, Jesse D,Bloom, Tobias,Marschall, Evan E,Eichler

medRxiv : the preprint server for health sciences · 2026-07-04

pmid:42428052

Establishment and Molecular Characterization of a Short-Term Primary Culture Derived From Invasive Micropapillary Carcinoma of the Breast.

Mamta,Gurav, Omshree,Shetty, Shalaka,Joshi, Seema,Gulia, Rohan,Chaubal, Sudeep,Gupta, Tanuja,Shet

Cell biology international · 2026-06-01

pmid:42175825

Single-Molecule Real-Time Sequencing for MUC1 Variable Number of Tandem Repeat Variation to Improve Autosomal Dominant Tubulointerstitial Kidney Disease Diagnosis.

Alena,Vrbacká, Anna,Přistoupilová, Kendrah O,Kidd, Václav,Janoušek, Martin,Radina, Petr,Vylet'al, Ibrahim,Bitar, Viktor,Stránecký, Lenka,Steiner-Mrázová, Helena,Trešlová, Jana,Sovová, Kateřina,Hodaňová, Hana,Hartmannová, Dita,Mušálková, Klára,Svojšová, Tereza,Kmochová, Veronika,Barešová, Heidi,Bleyer, Abby,Taylor, Lauren,Martin, Antonio,Sanchez, Romana,Ryšavá, Innet,Lajtmanová, Silvie,Rajnochová-Bloudíčková, Ondřej,Viklický, Gregory,Papagregoriou, Constantinos,Deltas, Christoforos,Stavrou, Sofia,Jorge, José António,Lopes, Márcia,Rodrigues, Elhussein,Elhassan, Michelle,Clince, Colm,Rowan, Peter,Conlon, Omri,Teltsh, Gianpiero L,Cavalleri, Brendan,Blumenstiel, Diana,Toledo, Marina,DiStefano, Matthew,DeFelice, Martina,Živná, Anthony J,Bleyer, Stanislav,Kmoch

Journal of the American Society of Nephrology : JASN · 2026-04-10

pmid:41961547

Inhibition of endocytosis by glycans arises from steric rather than electrostatic repulsion.

Advika,Kamatar, Jose A,Villalobos, Carl C,Hayden, Fabiola G,Rodriguez Flores, Stephanie,Archer-Hartmann, Parastoo,Azadi, Brian,Belardi, Sapun H,Parekh, Jeanne C,Stachowiak

Biophysical journal · 2026-03-13

pmid:41832605

Analysis of clinically relevant large tandem repeats using nanopore sequencing.

Silvia,Madritsch, David,Horner, Tamara,Löwenstern, Nadja,Brait, Vivienne,Arnold, Andrea,Wenzel, Denisa,Weis, Markus,Hengstschläger, Franco,Laccone

Scientific reports · 2025-12-04

pmid:41345522

Clinical use of the VNtyper-Kestrel pipeline for MUC1 variant detection in autosomal-dominant tubulointerstitial kidney disease.

China,Nagano, Naoya,Morisada, Yuta,Inoki, Yu,Tanaka, Yuta,Ichikawa, Chika,Ueda, Hideaki,Kitakado, Yuya,Aoto, Nana,Sakakibara, Tomoko,Horinouchi, Tomohiko,Yamamura, Shingo,Ishimori, Kandai,Nozu

Clinical and experimental nephrology · 2025-04-17

pmid:40244446

Phenotypic Heterogeneity of ADTKD-MUC1 Diagnosed Using VNtyper, a Novel Genetic Technique.

Jessica,Kachmar, Hassan,Saei, Vincent,Morinière, Laurence,Heidet, Bertrand,Knebelmann, Olivier,Gribouval, Manon,Mautret-Godefroy, Stéphane,Burtey, Vincent,Vuiblet, Asma,Alla, Axel,Ibalanky, Olivier,Moranne, Mathilde,Nizon, Benjamin,Savenkoff, Patrick,Nitschké, Corinne,Antignac, Guillaume,Dorval

American journal of kidney diseases : the official journal of the National Kidney Foundation · 2025-01-22

pmid:39848530

Jeff,Granhøj, Dorte L,Lildballe, Katja V,Pedersen, Birgitte G,Tougaard, Martin,Sokol, Mads M,Aagaard, Annabeth H,Petersen, Tilde,Kristensen, Malene,Djursby, Henrik,Birn, Maria,Rasmussen

Clinical kidney journal · 2024-11-18

pmid:39781475