Locus MODY8 CEL

Disease ID
MODY8
Gene ID
CEL
Updated
Jun 24, 2026
v2.23.0
Other gene loci
Bioinformatical Links
Suggest Edit

Disease

Name Maturity-Onset Diabetes of the Young Type 8
Inheritance
Description
Maturity-onset diabetes of the young type 8 (MODY8) is characterized by onset of diabetes before age 25 years, with slowly progressive pancreatic exocrine dysfunction, fatty replacement of pancreatic parenchyma (lipomatosis), and development of pancreatic cysts . Other types of this disease have been associated with various genes and variant types, notably whole gene or whole exon deletions . In some CEL VNTR deletion carriers, chronic pancreatitis may precede diabetes, and one reported family had hereditary pancreatitis as the predominant phenotype . Comorbidity has been proposed between MODY and fecal elastase deficiency (FED) .
Prevalence
Found in individuals of Danish and Norwegian ancestry, .
Age of Onset Age of Onset(Typical)Years11  170  0
11-17
HPO Terms
Association
Mendelian

Locus

Details
The locus contains 17 imperfect 33 bp motifs, with a stretch of 7 perfect GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG motifs. Several pathogenic mutations have been proposed. The most supported pathogenic variants are single base deletions in the proximal VNTR, reported in repeat segments 1, 4, and 5 . One reported proximal VNTR deletion is a 1bp deletion of (C)8 to (C)7 within the VNTR, causing a motif change (this is the pathogenic motif represented here). Distal CEL VNTR single-base insertions, particularly INS9/INS10/INS12, have been reported as likely benign polymorphisms, while proximal insertion variants may have greater pathogenic potential . Also, a contraction that deletes one of the VNTR repeats may be pathogenic, with reduced penetrance, although evidence for this is sparse . Another study identified a c.2041_2042delinsCGG p.(Val681Argfs*6) mutation in the 12th motif (one of the imperfect motifs) . Several non-tandem repeat pathogenic MODY variants have also been reported in this gene. Given limited data and multiple proposed pathogenic variants, the normal and pathogenic ranges are currently difficult to define.
Mechanism
GoF
Proximal CEL VNTR frameshift variants alter the C-terminal tandem-repeat domain and become pathogenic through protein misfolding and proteotoxic gain-of-function. Pathogenic proximal deletion variants show increased aggregation, reduced secretion, ER stress, and unfolded protein response, while enzymatic activity is largely preserved,, . Functional testing of CEL VNTR insertion variants showed that proximal insertions had greater aggregation and UPR effects .
Detection
Year
2005
Location in Gene
Exon 11
Gene Strand

Alleles

Ref. Motif
GGCCCCCCCCGTGCCGCCCACGGGTGACTCCGG
Ranges BenignIntermediatePathogenicUnits0  00  00  0
Benign (ref.)
Benign (gene)
Pathogenic (ref.)
ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC
Pathogenic (gene)
ACGGGTGACTCCGGGGCCCCCCCGTGCCGCCC
Unknown (ref.)
Unknown (gene)
Interruption (ref.)
Interruption (gene)

References

Direct supporting references for info on this page.

3
Two New Mutations in the CEL Gene Causing Diabetes and Hereditary Pancreatitis: How to Correctly Identify MODY8 Cases.
Khadija,El Jellas, Petra,Dušátková, Ingfrid S,Haldorsen, Janne,Molnes, Erling,Tjora, Bente B,Johansson, Karianne,Fjeld, Stefan,Johansson, Štěpánka,Průhová, Leif,Groop, J Matthias,Löhr, Pål R,Njølstad, Anders,Molven
The Journal of clinical endocrinology and metabolism · 2022-03-24
pmid:34850019
5
Mutations in the CEL VNTR cause a syndrome of diabetes and pancreatic exocrine dysfunction.
Helge,Raeder, Stefan,Johansson, Pål I,Holm, Ingfrid S,Haldorsen, Eric,Mas, Véronique,Sbarra, Ingrid,Nermoen, Stig A,Eide, Louise,Grevle, Lise,Bjørkhaug, Jørn V,Sagen, Lage,Aksnes, Oddmund,Søvik, Dominique,Lombardo, Anders,Molven, Pål Rasmus,Njølstad
Nature genetics · 2005-12-20
pmid:16369531
6
Mutations in the VNTR of the carboxyl-ester lipase gene (CEL) are a rare cause of monogenic diabetes.
Janniche,Torsvik, Stefan,Johansson, Anders,Johansen, Jakob,Ek, Jayne,Minton, Helge,Raeder, Sian,Ellard, Andrew,Hattersley, Oluf,Pedersen, Torben,Hansen, Anders,Molven, Pål R,Njølstad
Human genetics · 2009-09-17
pmid:19760265
7
Common single-base insertions in the VNTR of the carboxyl ester lipase (CEL) gene are benign and also likely to arise somatically in the exocrine pancreas.
Ranveig S,Brekke, Anny,Gravdal, Khadija,El Jellas, Grace E,Curry, Jianguo,Lin, Steven J,Wilhelm, Solrun J,Steine, Eric,Mas, Stefan,Johansson, Mark E,Lowe, Bente B,Johansson, Xunjun,Xiao, Karianne,Fjeld, Anders,Molven
Human molecular genetics · 2024-05-18
pmid:38483348
8
Unraveling the genetic basis of MODY: insights from next-generation sequencing.
Metin,Eser, Gulam,Hekimoglu, Fatma,Dursun
Journal of applied genetics · 2024-10-03
pmid:39361122
9
Diabetes and pancreatic exocrine dysfunction due to mutations in the carboxyl ester lipase gene-maturity onset diabetes of the young (CEL-MODY): a protein misfolding disease.
Bente B,Johansson, Janniche,Torsvik, Lise,Bjørkhaug, Mette,Vesterhus, Anja,Ragvin, Erling,Tjora, Karianne,Fjeld, Dag,Hoem, Stefan,Johansson, Helge,Ræder, Susanne,Lindquist, Olle,Hernell, Miriam,Cnop, Jaakko,Saraste, Torgeir,Flatmark, Anders,Molven, Pål R,Njølstad
The Journal of biological chemistry · 2011-07-22
pmid:21784842
10
A Carboxyl Ester Lipase (CEL) Mutant Causes Chronic Pancreatitis by Forming Intracellular Aggregates That Activate Apoptosis.
Xunjun,Xiao, Gabrielle,Jones, Wednesday A,Sevilla, Donna B,Stolz, Kelsey E,Magee, Margaret,Haughney, Amitava,Mukherjee, Yan,Wang, Mark E,Lowe
The Journal of biological chemistry · 2016-09-20
pmid:27650499
11
The position of single-base deletions in the VNTR sequence of the carboxyl ester lipase (CEL) gene determines proteotoxicity.
Anny,Gravdal, Xunjun,Xiao, Miriam,Cnop, Khadija,El Jellas, Stefan,Johansson, Pål R,Njølstad, Mark E,Lowe, Bente B,Johansson, Anders,Molven, Karianne,Fjeld
The Journal of biological chemistry · 2021-04-14
pmid:33862081

Additional Literature

Additional literature related to this locus.

Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem repeats, and disease, in medline format)

Dexamethasone prophylaxis for excessive lymphocyte expansion after cilta-cel in multiple myeloma.
Peter A,Forsberg, Jacqueline A,Turner, Marita,Meyer, Diana,Abbott, Sara,Nicholson, Henning,Schade, Jeffrey,Matous, Tara,Gregory
Blood advances · 2026-05-26
pmid:41894686
Routine Monitoring of CAR-T-Cells Expansion and Persistence in Patients With Aggressive Large B-Cell Lymphoma by Flow Cytometry: A Single-Center Experience.
Alexandra,Zduniak, Jérémie,Martinet, Emilie,Lévêque, Stéphanie,Becker, David,Tonnelet, Elodie Dos,Santos, Claire,Leroy, Mustafa,Alani, Jean,Rouvet, Marine,Brousseau, Camille,Giverne, Alexis,Cuffel, Serge,Jacquot, Arnaud,Roucheux, Alice,Veuiller, Nicolas,Lecornu, Misa Eugene,Norbert, Olivier,Boyer, Hervé,Tilly, Fabrice,Jardin, Jean-Baptiste,Latouche, Vincent,Camus
Hematological oncology · 2025-11-01
pmid:41057236
Early-onset diabetes with low utilization of lipid as an energy source carrying a rare missense mutation in the CEL gene.
Ayana,Fujii, Hiroko,Nakabayashi, Yuko,Nagao, Masaru,Akiyama, Akihiko,Taguchi, Kaito,Yorimoto, Risako,Hamada, Issei,Saeki, Naoki,Yamamoto, Taro,Takami, Kenji,Watanabe, Yoichi,Mizukami, Yasuharu,Ohta
Endocrinology, diabetes & metabolism case reports · 2025-08-18
pmid:40840513
Characterizing Cellular Expansion of Idecabtagene Vicleucel and Association with Clinical Efficacy and Safety in Patients with Triple-Class-Exposed Relapsed/Refractory Multiple Myeloma.
Fan,Wu, Xirong,Zheng, Joseph,Burnett, Madhan,Masilamani, Wanying,Zhang, Xiaobo,Zhong, Andrea,Caia, Mark,Cook, Julia,Piasecki, Anna,Kondic, Manisha,Lamba, Jian,Zhou
Journal of clinical pharmacology · 2025-07-10
pmid:40641008
Brexucabtagene autoleucel in-vivo expansion and BTKi refractoriness have a negative influence on progression-free survival in mantle cell lymphoma: Results from CART-SIE study.
Federico,Stella, Annalisa,Chiappella, Martina,Magni, Francesca,Bonifazi, Chiara,De Philippis, Maurizio,Musso, Ilaria,Cutini, Silva,Ljevar, Anna Maria,Barbui, Mirko,Farina, Massimo,Martino, Massimo,Massaia, Giovanni,Grillo, Piera,Angelillo, Barbara,Botto, Francesca,Patriarca, Mauro,Krampera, Luca,Arcaini, Maria Chiara,Tisi, Pierluigi,Zinzani, Federica,Sorà, Stefania,Bramanti, Martina,Pennisi, Cristiana,Carniti, Paolo,Corradini
British journal of haematology · 2024-12-22
pmid:39710966
Common single-base insertions in the VNTR of the carboxyl ester lipase (CEL) gene are benign and also likely to arise somatically in the exocrine pancreas.
Ranveig S,Brekke, Anny,Gravdal, Khadija,El Jellas, Grace E,Curry, Jianguo,Lin, Steven J,Wilhelm, Solrun J,Steine, Eric,Mas, Stefan,Johansson, Mark E,Lowe, Bente B,Johansson, Xunjun,Xiao, Karianne,Fjeld, Anders,Molven
Human molecular genetics · 2024-05-18
pmid:38483348
Unlocking Predictive Power: Quantitative Assessment of CAR-T Expansion with Digital Droplet Polymerase Chain Reaction (ddPCR).
Eugenio,Galli, Marcello,Viscovo, Federica,Fosso, Ilaria,Pansini, Giacomo,Di Cesare, Camilla,Iacovelli, Elena,Maiolo, Federica,Sorà, Stefan,Hohaus, Simona,Sica, Silvia,Bellesi, Patrizia,Chiusolo
International journal of molecular sciences · 2024-02-26
pmid:38473919
Early Chimeric Antigen Receptor T Cell Expansion Is Associated with Prolonged Progression-Free Survival for Patients with Relapsed/Refractory Multiple Myeloma Treated with Ide-Cel: A Retrospective Monocentric Study.
Leo,Caillot, Emmanuel,Sleiman, Ingrid,Lafon, Marie-Lorraine,Chretien, Pauline,Gueneau, Alexandre,Payssot, Romain,Pedri, Daniela,Lakomy, François,Bailly, Julien,Guy, Jean-Pierre,Quenot, Herve,Avet-Loiseau, Denis,Caillot
Transplantation and cellular therapy · 2024-03-07
pmid:38458477
The genetic risk factor CEL-HYB1 causes proteotoxicity and chronic pancreatitis in mice.
Karianne,Fjeld, Anny,Gravdal, Ranveig S,Brekke, Jahedul,Alam, Steven J,Wilhelm, Khadija,El Jellas, Helene N,Pettersen, Jianguo,Lin, Marie H,Solheim, Solrun J,Steine, Bente B,Johansson, Pål R,Njølstad, Caroline S,Verbeke, Xunjun,Xiao, Mark E,Lowe, Anders,Molven
Pancreatology : official journal of the International Association of Pancreatology (IAP) ... [et al.] · 2022-11-09
pmid:36379850