Locus NIID NOTCH2NLC
Disease ID
NIID
Gene ID
NOTCH2NLC
Updated
Aug 24, 2026
v2.26.0
v2.26.0
Other gene loci
–
Clinical Links
Bioinformatical Links
Disease
Name Neuronal intranuclear inclusion disease, Alzheimer disease and parkinsonism phenotype, Oculopharyngodistal myopathy (OPDM) type 3, hereditary essential tremor type 6
Inheritance
Description Neuronal intranuclear inclusion disease (NIID) is a very rare multisystem neurodegenerative disorder characterized by the presence of eosinophilic intranuclear inclusions in neuronal and glial cells, and neuronal loss1 . Stroke-like episodes may occur in over one third of patients and can be misdiagnosed as recurrent ischemic stroke2,3 . Often presents with gastrointestinal symptoms, including chronic refractory nausea, which preceded neurologic manifestations by decades in one documented case4 . Renal, bladder, and other visceral organ involvement have been reported and may occasionally precede neurological symptoms5,6 . Subclinical peripheral neuropathy has been reported in NOTCH2NLC-related NIID7 . Due to overlapping phenotypes and the shared locus, it is unclear whether these four diseases are comorbid, synonymous, or entirely separate.
HPO Terms
HP:0000020 Urinary incontinenceHP:0000600 Abnormality of the pharynxHP:0000602 OphthalmoplegiaHP:0000616 MiosisHP:0000639 NystagmusHP:0000648 Optic atrophyHP:0000708 Atypical behaviorHP:0000726 DementiaHP:0001250 SeizureHP:0001251 AtaxiaHP:0001260 DysarthriaHP:0001265 HyporeflexiaHP:0001276 HypertoniaHP:0001279 SyncopeHP:0001288 Gait disturbanceHP:0001324 Muscle weaknessHP:0001337 TremorHP:0001347 HyperreflexiaHP:0002063 RigidityHP:0002119 VentriculomegalyHP:0002167 Abnormal speech patternHP:0002352 LeukoencephalopathyHP:0002353 EEG abnormalityHP:0002572 Episodic vomitingHP:0002650 ScoliosisHP:0002922 Increased CSF protein concentrationHP:0003298 Spina bifida occultaHP:0003312 Abnormal vertebral body morphologyHP:0003403 EMG: decremental response of compound muscle action potential to repetitive nerve stimulationHP:0003431 Decreased motor nerve conduction velocityHP:0003448 Decreased sensory nerve conduction velocityHP:0003457 EMG abnormalityHP:0003474 Somatic sensory dysfunctionHP:0007185 Loss of consciousnessHP:0012229 CSF pleocytosisHP:0020068 Intranuclear inclusion bodiesHP:0100022 Abnormality of movementHP:0100543 Cognitive impairment
Association
Mendelian
Locus
Details Benign alleles are less than 38 repeats, while pathogenic alleles contain 66+ repeats13 . Intermediate alleles may be associated with a phenotypic spectrum, and even pathogenic cases can have variable phenotype14,15 : NOTCH2NLC expansions have been linked to Alzheimer's disease and Parkinson's disease, leading to a potential role in NIID-related disorders16 . Age of onset inversely related to allele size17 . Motif variation in controls: (AGG)(CGG)n(AGG)0-3(CGG)0-2. GGA and AGC interruptions may influence phenotype18 . Interruptions documented: GGA, GGG19 ; ACCGAGAAGATGCCCGCCCTGC interruption proposed but not confirmed20 . Detection may be challenging due to paralogy between genes: C253572.1, NOTCH2, NOTCH2NL, NBPF14, NBPF19.
Mechanism Polyglycine expansion; may relate to methylation or RNA pathogenicity10,21,20 . Proposed mechanisms include toxic uN2CpolyG/polyglycine aggregation, RNA pathogenicity, impaired autophagy, mitochondrial dysfunction, and innate immune activation5 . The polyglycine-containing protein sequesters a key subunit of transcription factor NF-κB in nuclear inclusions, leading to impaired autophagy22 . Tau pathology is evident; changes in p-tau levels and tau deposition have been reported23 . Expanded polyG proteins also induce nucleolar stress through interaction with NPM1 and rRNA. This disrupts ribosomal homeostasis and alters 3D chromatin organization through reduced CTCF/RAD21 expression24 . Aggregates of a second polyglycine protein translated from NOTCH2NLC variant 2 are present in the majority of p62-positive intranuclear inclusions in patient skin and skeletal muscle and co-localize with uN2CpolyG25 .
GoF
Detection
Year Year first published 201929
Location in Gene
5' UTR
Gene Strand
Alleles
Ref. Motif Reference motif, reference orientation
CGG
Ranges
Benign (ref.) Benign motif, reference orientation
–
Benign (gene) Benign motif, gene orientation
–
Pathogenic (ref.) Pathogenic motif, reference orientation
CGG
Pathogen. (gene) Pathogenic motif, gene orientation
CGG
Unknown (ref.) Unknown motif, reference orientation
–
Unknown (gene) Unknown motif, gene orientation
–
Interruption (ref.) Interruption motif, reference orientation
AGG, CAG
Interrup. (gene) Interruption motif, gene orientation
AGG, CAG
gnomAD
Pathogenic genotype frequency data is not displayed for this locus because a substantial number of large alleles failed manual review by the gnomAD team.
References
Direct supporting references for info on this page.
1
Ontology Lookup Service (OLS)
mondo:00113272
Clinical features of
Yun,Tian, Lu,Zhou, Jing,Gao, Bin,Jiao, Sizhe,Zhang, Qiao,Xiao, Jin,Xue, Ying,Wang, Hui,Liang, Yaling,Liu, Guang,Ji, Chenhui,Mao, Caiyan,Liu, Liling,Dong, Long,Zhang, Shugang,Zhang, Jiping,Yi, Guohua,Zhao, Yingying,Luo, Qiying,Sun, Yafang,Zhou, Fang,Yi, Xiaoyu,Chen, Chaojun,Zhou, Nina,Xie, Mengchuan,Luo, Lingyan,Yao, Yacen,Hu, Mengqi,Zhang, Qiuming,Zeng, Liangjuan,Fang, Hong-Yu,Long, Yuanyuan,Xie, Ling,Weng, Si,Chen, Juan,Du, Qian,Xu, Li,Feng, Qing,Huang, Xuan,Hou, Junpu,Wang, Bin,Xie, Lin,Zhou, Lili,Long, Ji-Feng,Guo, Junling,Wang, Xinxiang,Yan, Hong,Jiang, Hongwei,Xu, Ranhui,Duan, Beisha,Tang, Lu,Shen
Journal of neurology, neurosurgery, and psychiatry · 2022-09-23
pmid:361508443
Neuronal intranuclear inclusion disease in patients with adult-onset non-vascular leukoencephalopathy.
Yi Hong,Liu, Ying Tsen,Chou, Fu Pang,Chang, Wei Ju,Lee, Yuh Cherng,Guo, Cheng Ta,Chou, Hui Chun,Huang, Takeshi,Mizuguchi, Chien Chen,Chou, Hsiang Yu,Yu, Kai Wei,Yu, Hsiu Mei,Wu, Pei Chien,Tsai, Naomichi,Matsumoto, Yi Chung,Lee, Yi Chu,Liao
Brain : a journal of neurology · 2022-09-14
pmid:354113974
Neuronal intranuclear inclusion disease with initial manifestation of intractable nausea and vomiting responsive to corticosteroids: a case report.
Long,Luo, Ling,Zhu, Yong,Liang, Ying,Yuan, Lei,Chen, Weiwen,Peng, Gao,Yang, Ronghe,Yang
Frontiers in immunology · 2026-03-18
pmid:419295015
Immunological characterization of neuronal intranuclear inclusion disease with kidney injury: an exploratory analysis in a multi-center cohort.
Ying,Ji, Xiaowen,Li, Jin,Tian, Xian,Chen, Guang,Ji, Maofeng,Shi, Jing,Zhang, Man,Xia, Qianru,An, Xiang,Li, Liangyu,Li, Wenjing,Song, Ruixue,Zhang, Lei,Bao, Yuqiao,Wang, Yingying,Cui, Yuyao,Tian, Hao,Chen
Frontiers in immunology · 2026-04-14
pmid:420582196
Adult-Onset Neuronal Intranuclear Inclusion Disease Initially Manifesting as Bladder Dysfunction: A Case Report.
Anna,Yamaki, Hirofumi,Sekino, Satoshi,Kawana, Ryo,Yamakuni, Shiro,Ishii, Hiroshi,Ito
Cureus · 2026-03-19
pmid:420051697
Subclinical peripheral nerve demyelination without overt symptoms in a family with neuronal intranuclear inclusion disease harboring biallelic repeat expansions.
Hang,Zhang, Taiqi,Zhao, Honglin,Zheng, Suying,Duan, Chenyang,Liu, Yaochong,Zhang, Qiang,Li, Han,Liu, Haiyang,Luo, Yuming,Xu
BMC neurology · 2026-04-18
pmid:420010028
Heterogenous Genetic, Clinical, and Imaging Features in Patients with Neuronal Intranuclear Inclusion Disease Carrying
Yusran Ady,Fitrah, Yo,Higuchi, Norikazu,Hara, Takayoshi,Tokutake, Masato,Kanazawa, Kazuhiro,Sanpei, Tomone,Taneda, Akihiko,Nakajima, Shin,Koide, Shintaro,Tsuboguchi, Midori,Watanabe, Junki,Fukumoto, Shoichiro,Ando, Tomoe,Sato, Yohei,Iwafuchi, Aki,Sato, Hideki,Hayashi, Takanobu,Ishiguro, Hayato,Takeda, Toshiaki,Takahashi, Nobuyoshi,Fukuhara, Kensaku,Kasuga, Akinori,Miyashita, Osamu,Onodera, Takeshi,Ikeuchi
Brain sciences · 2023-06-15
pmid:373714339
Neurological disorders caused by novel non-coding repeat expansions: clinical features and differential diagnosis.
Elisa,Vegezzi, Hiroyuki,Ishiura, D Cristopher,Bragg, David,Pellerin, Francesca,Magrinelli, Riccardo,Currò, Stefano,Facchini, Arianna,Tucci, John,Hardy, Nutan,Sharma, Matt C,Danzi, Stephan,Zuchner, Bernard,Brais, Mary M,Reilly, Shoji,Tsuji, Henry,Houlden, Andrea,Cortese
The Lancet. Neurology · 2024-07-01
pmid:3887675011
Clinical Features and Classification of Neuronal Intranuclear Inclusion Disease.
Hongfei,Tai, An,Wang, Yumei,Zhang, Shaocheng,Liu, Yunzhu,Pan, Kai,Li, Guixian,Zhao, Mengwen,Wang, Guode,Wu, Songtao,Niu, Hua,Pan, Bin,Chen, Wei,Li, Xingao,Wang, Gehong,Dong, Wei,Li, Ying,Zhang, Sheng,Guo, Xiaoyun,Liu, Mingxia,Li, Hui,Liang, Ming,Huang, Wei'an,Chen, Zaiqiang,Zhang
Neurology. Genetics · 2023-02-28
pmid:3709093412
Rapidly progressive adult-onset neuronal intranuclear inclusion disease beginning with autonomic symptoms: a case report.
Yi,Zhu, Qian,Yang, Yun,Tian, Weibing,Fan, Xinfa,Mao
Frontiers in neurology · 2023-05-25
pmid:3730575013
Resources for Genetics Professionals — Genetic Disorders Caused by Nucleotide Repeat Expansions and Contractions
Stephanie E.,Wallace, Lora JH,Bean
GeneReviews® [Internet] · 2022-10-20
genereviews:NBK53514815
Familial adult-onset neuronal intranuclear inclusion disease: A case report and literature review.
Lijun,Wei, Jiaqi,Wang, Changming,Xu, Tengchao,Yang, Yun,Tian, Lu,Shen
Medicine · 2024-11-01
pmid:3949600516
Expansion of Human-Specific GGC Repeat in Neuronal Intranuclear Inclusion Disease-Related Disorders.
Yun,Tian, Jun-Ling,Wang, Wen,Huang, Sheng,Zeng, Bin,Jiao, Zhen,Liu, Zhao,Chen, Yujing,Li, Ying,Wang, Hao-Xuan,Min, Xue-Jing,Wang, Yong,You, Ru-Xu,Zhang, Xiao-Yu,Chen, Fang,Yi, Ya-Fang,Zhou, Hong-Yu,Long, Chao-Jun,Zhou, Xuan,Hou, Jun-Pu,Wang, Bin,Xie, Fan,Liang, Zhuan-Yi,Yang, Qi-Ying,Sun, Emily G,Allen, Andrew Mark,Shafik, Ha Eun,Kong, Ji-Feng,Guo, Xin-Xiang,Yan, Zheng-Mao,Hu, Kun,Xia, Hong,Jiang, Hong-Wei,Xu, Ran-Hui,Duan, Peng,Jin, Bei-Sha,Tang, Lu,Shen
American journal of human genetics · 2019-06-06
pmid:3117812617
Neuronal Intranuclear Inclusion Disease with NOTCH2NLC GGC Repeat Expansion: A Systematic Review and Challenges of Phenotypic Characterization.
Tian,Zeng, Yiqun,Chen, Honghao,Huang, Shengqi,Li, Jiaqi,Huang, Haobo,Xie, Shenyi,Lin, Siyao,Chen, Guangyong,Chen, Dehao,Yang
Aging and disease · 2024-01-31
pmid:3837702618
The Phenotypes and Mechanisms of NOTCH2NLC-Related GGC Repeat Expansion Disorders: a Comprehensive Review.
Xiu-Rong,Huang, Bei-Sha,Tang, Peng,Jin, Ji-Feng,Guo
Molecular neurobiology · 2021-10-31
pmid:3471896419
Comprehensive genetic diagnosis of tandem repeat expansion disorders with programmable targeted nanopore sequencing.
Igor,Stevanovski, Sanjog R,Chintalaphani, Hasindu,Gamaarachchi, James M,Ferguson, Sandy S,Pineda, Carolin K,Scriba, Michel,Tchan, Victor,Fung, Karl,Ng, Andrea,Cortese, Henry,Houlden, Carol,Dobson-Stone, Lauren,Fitzpatrick, Glenda,Halliday, Gianina,Ravenscroft, Mark R,Davis, Nigel G,Laing, Avi,Fellner, Marina,Kennerson, Kishore R,Kumar, Ira W,Deveson
Science advances · 2022-03-04
pmid:3524511020
Sequence composition changes in short tandem repeats: heterogeneity, detection, mechanisms and clinical implications.
Indhu-Shree,Rajan-Babu, Egor,Dolzhenko, Michael A,Eberle, Jan M,Friedman
Nature reviews. Genetics · 2024-03-11
pmid:3846778421
Clinical and neuroimaging review of triplet repeat diseases.
Ryo,Kurokawa, Mariko,Kurokawa, Akihiko,Mitsutake, Moto,Nakaya, Akira,Baba, Yasuhiro,Nakata, Toshio,Moritani, Osamu,Abe
Japanese journal of radiology · 2022-09-28
pmid:3616976822
uN2CpolyG-mediated p65 nuclear sequestration suppresses the NF-κB-NLRP3 pathway in neuronal intranuclear inclusion disease.
Yu,Shen, Kaiyan,Jiang, Dandan,Tan, Min,Zhu, Yusen,Qiu, Pencheng,Huang, Wenquan,Zou, Jianwen,Deng, Zhaoxia,Wang, Ying,Xiong, Daojun,Hong
Cell communication and signaling : CCS · 2025-02-07
pmid:3992069023
Plasma p-tau species are elevated in presymptomatic and symptomatic neuronal intranuclear inclusion disease.
Sizhe,Zhang, Bin,Jiao, Yan,Zeng, Qiying,Sun, Xiaoyu,Chen, Weiwei,Zhang, Ziyu,Ouyang, Qiao,Xiao, Lu,Zhou, Yunni,Li, Ling,Weng, Juan,Du, Qian,Xu, Yang,Yang, Mengqi,Zhang, Qiuming,Zeng, Liangjuan,Fang, Hongyu,Long, Yuanyuan,Xie, Si,Chen, Li,Feng, Qing,Huang, Lili,Long, Yafang,Zhou, Fang,Yi, Yacen,Hu, Qiong,Liu, Yongcheng,Pan, Lin,Zhou, Yulai,Li, Shuo,Hu, Jifeng,Guo, Junling,Wang, Hong,Jiang, Hongwei,Xu, Ranhui,Duan, Beisha,Tang, Yun,Tian, Lu,Shen
EBioMedicine · 2026-01-14
pmid:4153918524
ASO therapy rescues NOTCH2NLC GGC repeat expansion-induced genomic damage, 3D chromatin structural abnormalities, and senescence.
Mengjie,Li, Mibo,Tang, Xiaoyan,Hao, Zhengwei,Hu, Dongrui,Ma, Shuangjie,Li, Chunyan,Zuo, Zhiyun,Wang, Yuanyuan,Liang, Yanmei,Feng, Chenwei,Hao, Chen,Wang, Huanyu,Li, Yalan,Yang, Yuemeng,Sun, Shasha,Qi, Chengyuan,Mao, Yuming,Xu, Qun,Wang, De,Yang, Ruwei,Yang, Ziyao,Zhou, Peilin,Ji, Song,Tan, Zaiqiang,Zhang, Hao,Chen, Albert R,La Spada, Changhe,Shi
Nature communications · 2026-04-07
pmid:4194245525
A Second Pathogenic Protein, PolyGN2C-iso2, Reveals a Dual-Protein Pathology in Neuronal Intranuclear Inclusion Disease.
Kang,Zhang, Wenhao,Ma, Yi,Zhou, Zhijie,Wu, Pan,Gao, Hongze,Niu, Hongfei,Tai, Tianyi,Zhao, Zheyue,Dong, Li,Li, Yan,Zhang, An,Wang, Si,Shen, Yueyang,Li, Sifei,Yu, Yan,Peng, Wang,Sheng, Xiaoyan,Dong, Hua,Pan, Kaibin,Shi, Magdalena J,Koziol, Xiaobing,Wu, Zaiqiang,Zhang
Advanced science (Weinheim, Baden-Wurttemberg, Germany) · 2026-07-23
pmid:4248934527
Saliva-Based Triple-Primed PCR as a Non-Invasive Tool for Detecting NOTCH2NLC GGC Repeat Expansions in NIID.
Yangye,Lian, Shaoping,Zhong, Jingzhen,Liang, Yuzhe,Li, Xing,Chen, Xin,Wang, Jing,Ding
Clinical laboratory · 2026-07-01
pmid:4241167728
Father-to-offspring transmission of extremely long NOTCH2NLC repeat expansions with contractions: genetic and epigenetic profiling with long-read sequencing.
Hiromi,Fukuda, Daisuke,Yamaguchi, Kristofor,Nyquist, Yasushi,Yabuki, Satoko,Miyatake, Yuri,Uchiyama, Kohei,Hamanaka, Ken,Saida, Eriko,Koshimizu, Naomi,Tsuchida, Atsushi,Fujita, Satomi,Mitsuhashi, Kazuyuki,Ohbo, Yuki,Satake, Jun,Sone, Hiroshi,Doi, Keisuke,Morihara, Tomoko,Okamoto, Yuji,Takahashi, Aaron M,Wenger, Norifumi,Shioda, Fumiaki,Tanaka, Naomichi,Matsumoto, Takeshi,Mizuguchi
Clinical epigenetics · 2021-11-13
pmid:3477411129
Noncoding CGG repeat expansions in neuronal intranuclear inclusion disease, oculopharyngodistal myopathy and an overlapping disease.
Hiroyuki,Ishiura, Shota,Shibata, Jun,Yoshimura, Yuta,Suzuki, Wei,Qu, Koichiro,Doi, M Asem,Almansour, Junko Kanda,Kikuchi, Makiko,Taira, Jun,Mitsui, Yuji,Takahashi, Yaeko,Ichikawa, Tatsuo,Mano, Atsushi,Iwata, Yasuo,Harigaya, Miho Kawabe,Matsukawa, Takashi,Matsukawa, Masaki,Tanaka, Yuichiro,Shirota, Ryo,Ohtomo, Hisatomo,Kowa, Hidetoshi,Date, Aki,Mitsue, Hiroyuki,Hatsuta, Satoru,Morimoto, Shigeo,Murayama, Yasushi,Shiio, Yuko,Saito, Akihiko,Mitsutake, Mizuho,Kawai, Takuya,Sasaki, Yusuke,Sugiyama, Masashi,Hamada, Gaku,Ohtomo, Yasuo,Terao, Yoshihiko,Nakazato, Akitoshi,Takeda, Yoshio,Sakiyama, Yumi,Umeda-Kameyama, Jun,Shinmi, Katsuhisa,Ogata, Yutaka,Kohno, Shen-Yang,Lim, Ai Huey,Tan, Jun,Shimizu, Jun,Goto, Ichizo,Nishino, Tatsushi,Toda, Shinichi,Morishita, Shoji,Tsuji
Nature genetics · 2019-07-22
pmid:31332380Additional Literature
Additional literature related to this locus.
Raw PubMed search results
(All PubMed results returned by searching for this gene, tandem
repeats, and disease, in medline format)
Novel proteomics and neuropathology of
Feixia,Zhan, Jiaxin,Zhu, Yang,Wang, Yuwen,Cao, Xiya,Shen, Wenlu,Lv, Jiewei,Wei, Xiaojun,Huang, Steven X,Hou, Xinghua,Luan, Li,Cao
Frontiers in aging neuroscience · 2026-07-03
pmid:42490784A Second Pathogenic Protein, PolyGN2C-iso2, Reveals a Dual-Protein Pathology in Neuronal Intranuclear Inclusion Disease.
Kang,Zhang, Wenhao,Ma, Yi,Zhou, Zhijie,Wu, Pan,Gao, Hongze,Niu, Hongfei,Tai, Tianyi,Zhao, Zheyue,Dong, Li,Li, Yan,Zhang, An,Wang, Si,Shen, Yueyang,Li, Sifei,Yu, Yan,Peng, Wang,Sheng, Xiaoyan,Dong, Hua,Pan, Kaibin,Shi, Magdalena J,Koziol, Xiaobing,Wu, Zaiqiang,Zhang
Advanced science (Weinheim, Baden-Wurttemberg, Germany) · 2026-07-23
pmid:42489345PolyG Fibrils Coalesce Into Nuclear Ribbons That Engage Proteostasis Machinery in Neuronal Intranuclear Inclusion Disease.
Hui,Dong, Yongcheng,Pan, Zhiyao,Tang, Yuxuan,Yao, Guicong,Zhang, Junpu,Wang, Haonan,Xiao, Yun,Tian, Beisha,Tang, Dan,Li, Qiang,Guo, Ruijun,Tian, Qiong,Liu, Cong,Liu
Advanced science (Weinheim, Baden-Wurttemberg, Germany) · 2026-07-20
pmid:42474087Saliva-Based Triple-Primed PCR as a Non-Invasive Tool for Detecting NOTCH2NLC GGC Repeat Expansions in NIID.
Yangye,Lian, Shaoping,Zhong, Jingzhen,Liang, Yuzhe,Li, Xing,Chen, Xin,Wang, Jing,Ding
Clinical laboratory · 2026-07-01
pmid:42411677Evolutionary implications of
Si,Shen, Hong-Fei,Tai, Songtao,Niu, Hua,Pan, Xingao,Wang, Bin,Chen, Yuzhi,Shi, Hengheng,Wang, Shan,Lv, Yaou,Liu, Zaiqiang,Zhang
Brain communications · 2026-06-03
pmid:42396598Case Report: Neuronal intranuclear inclusion disease mimicking recurrent stroke in the setting of intracranial stenosis.
Jingmin,Zhao, Guangxun,Shen, Lumei,Chi
Frontiers in medicine · 2026-05-20
pmid:42245955Re-evaluating archival specimens as a pathologic diagnostic resource for neuronal intranuclear inclusion disease.
Yangye,Lian, Shaoping,Zhong, Jingzhen,Liang, Ke,Xu, Xin,Wang, Yuan,Ji, Jing,Ding
American journal of clinical pathology · 2026-05-05
pmid:42177789Unilateral Cortical Ribboning and Corticomedullary Lesions in a Rare Case of Coexisting Anti-N-methyl-D-aspartate Receptor Encephalitis and Neuronal Intranuclear Inclusion Disease.
Chen-Chang,Shih, Kuo-Hsuan,Chang
Acta neurologica Taiwanica · 2026-04-24
pmid:42033810A Case of Neuronal Intranuclear Inclusion Disease Mimicking Acute Stroke.
Junki,Yoshimura, Toshiyuki,Hayashi, Yu,Kashimoto, Yuki,Sakamoto, Kentaro,Suzuki, Chisato,Tamai, Jun,Sone, Satoshi,Suda
Internal medicine (Tokyo, Japan) · 2026-04-21
pmid:42021030